Notice: The website will be down for maintenance on Aug 18th (Sunday).

SGN Marker TG5

SGN-M260

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
700
Vector
pUC
Cutting Site
EcoR1/HindIII
Drug Resistance
AMP
Image
TG5 image not available
Forward sequence
GCCAAATCGAACATGTATGAGGCATTATTTGATTGACAAATAGATGAGGACCCATATGCCAAGGAAAAAAGGACATCTATAAAGCCATTC
GTATTATTTTTAATTTGCATTAAATAAAAATGTATTTACATCCCTTATTAAAACTAGGATATGCTTTTTTACAATTACTTCAATATAATT
TATGAATCCATTTCTAAATGTGTCTTCATTGGTATCTAATCTAATTATTTTATGTTACTTTTTTGTGCAGTGAATTTAGATTTAATTTTT
TATGATCATTGTATAATTTTTAGTTCTATTATATTCGCCCCCCCCCCCCCCCCCATTTTATGTTATTTATTCATATTATAATAAATAATT
GTTAGTATTGAAGTTTTCTTTTTATAAAATTAAGATATAATTAAAAAGATAATTCTAACAAATTCTTTTTACTAAAAGTATAAATAAAAT
TTATAAAGTCGCAAAAATATTTAAGGAATAAATTAATAAAATTATTTTTTTATTCATAATTTCGTGACAAACGTTTAAGTAGA
Reverse sequence
TGCATAAGGCATGCCAAATCAAACATGTATGAGGCATTATTTGATTGACAAATAGATGTGGACCCATATGCCAAGTAATAAAGGACATCT
ATTAAGCCATTCGTTTTATTTTTTATTTTCATTTTATAAAAATGTTTTTTCATTCCTTATTAAAACTAGTTTATGCTTTTTTACAATTAC
TTCAATATAATTTTTGTTTCCATTTTTAAATGATTCTTCATTGNTATCTAATCTAATTATTTTATGTTACTTTTTTGTGCAGTGCATTTA
GAATTAATTTTTTATGATCATTGAATGATTTTTAGTTCTATTATATTCGCCCCCCCCC
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 53343)
Chromosome
2
Position
41.81 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_2 MQTL_2_Late_blight_2 MQTL_3_Late_blight_2
Potato meta-QTL consensus map

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8750)
Chromosome
7
Position
21.70 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG5 was used as an overgo probe on plate 8 [well H12]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P007N09,   P184I12,   P050L11,   P140A10,   P017C13

 Overgo Sequences

A sequence
GACAAATAGATGAGGACCCATATG
B sequence
GTCCTTTTTTCCTTGGCATATGGG
AB sequence
GACAAATAGATGAGGACCCATATGCCAAGG
Marker sequence
GCCAAATCGAACATGTATGAGGCATTATTTGATTGACAAATAGATGAGGA
CCCATATGCCAAGGAAAAAAGGACATCTATAAAGCCATTCGTATTATTTT
TAATTTGCATTAAATAAAAATGTATTTACATCCCTTATTAAAACTAGGAT
ATGCTTTTTTACAATTACTTCAATATAATTTATGAATCCATTTCTAAATG
TGTCTTCATTGGTATCTAATCTAATTATTTTATGTTACTTTTTTGTGCAG
TGAATTTAGATTTAATTTTTTATGATCATTGTATAATTTTTAGTTCTATT
ATATTCGCCCCCCCCCCCCCCCCCATTTTATGTTATTTATTCATATTATA
ATAAATAATTGTTAGTATTGAAGTTTTCTTTTTATAAAATTAAGATATAA
TTAAAAAGATAATTCTAACAAATTCTTTTTACTAAAAGTATAAATAAAAT
TTATAAAGTCGCAAAAATATTTAAGGAATAAATTAATAAAATTATTTTTT
TATTCATAATTTCGTGACAAACGTTTAAGTAGA
Genomic location of TG5  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D260 marker 260
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)