SGN Marker solcap_snp_sl_7816

SGN-M26009

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 62340)
Chromosome
9
Position
0.83 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GGTGAAGGTTTCTCTTTCTCCGTCCCTTCCCGCGCTGCCGCTAACCAACT
  
3' flanking region
TATGTCTCCGAACTCGACCGCATTGTTCTCAAAGACAAATCATCGGCTCG
SNP nucleotide
CG
SNPdb format
GGTGAAGGTTTCTCTTTCTCCGTCCCTTCCCGCGCTGCCGCTAACCAACT[C/G]
TATGTCTCCGAACTCGACCGCATTGTTCTCAAAGACAAATCATCGGCTCG
  
Genomic location of solcap_snp_sl_7816  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D26009 marker 26009
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)