SGN Marker solcap_snp_sl_7829

SGN-M26012

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2000   
Map version
145 (location: 66276)
Chromosome
9
Position
80.99 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 62343)
Chromosome
9
Position
63.46 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AGTTCAAGCAAGGTGACATACTAATCAACACGTTCGTGCAATCGTTGCTC
  
3' flanking region
ATTGAGCAACAACTCCAGAACAGATCATCGCAAACATAATCGCGAAAAAA
SNP nucleotide
AG
SNPdb format
AGTTCAAGCAAGGTGACATACTAATCAACACGTTCGTGCAATCGTTGCTC[A/G]
ATTGAGCAACAACTCCAGAACAGATCATCGCAAACATAATCGCGAAAAAA
  
Genomic location of solcap_snp_sl_7829  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D26012 marker 26012
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)