SGN Marker solcap_snp_sl_8408

SGN-M26043

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 74453)
Chromosome
2
Position
12.11 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69970)
Chromosome
2
Position
22.17 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 66291)
Chromosome
2
Position
29.36 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 62374)
Chromosome
2
Position
31.91 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GTGTTCCTTACTCTCACAATGAAGTCAACGAACTCCGTTTTGTAGGTATC
  
3' flanking region
AGGGGAAACTTTGTTGCTTATAGTAGCAGCAAGTTAGTGTTACCTAAAGT
SNP nucleotide
AT
SNPdb format
GTGTTCCTTACTCTCACAATGAAGTCAACGAACTCCGTTTTGTAGGTATC[A/T]
AGGGGAAACTTTGTTGCTTATAGTAGCAGCAAGTTAGTGTTACCTAAAGT
  
Genomic location of solcap_snp_sl_8408  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D26043 marker 26043
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)