Notice: The SGN server upgrade is complete. Please let us know if you find any issues. :-)

SGN Marker solcap_snp_sl_8423

SGN-M26046

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69972)
Chromosome
2
Position
22.17 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 66293)
Chromosome
2
Position
28.02 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 62377)
Chromosome
2
Position
31.98 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TGTAGCGAGGGAAAGGAAACAAAGGGAAAAGAATACCATTAGTTTCATAA
  
3' flanking region
TGGAAGATAGGTTAGGGTCATCATACCAAAACGTTTACAAGTTCTGTATG
SNP nucleotide
AT
SNPdb format
TGTAGCGAGGGAAAGGAAACAAAGGGAAAAGAATACCATTAGTTTCATAA[A/T]
TGGAAGATAGGTTAGGGTCATCATACCAAAACGTTTACAAGTTCTGTATG
  
Genomic location of solcap_snp_sl_8423  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D26046 marker 26046
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)