Notice: Please give us important feedback on the future of SGN using this survey: https://www.surveymonkey.com/r/VJTRHVC

SGN Marker solcap_snp_sl_8655

SGN-M26071

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 74470)
Chromosome
1
Position
20.06 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 69982)
Chromosome
1
Position
20.84 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 62402)
Chromosome
1
Position
2.45 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CTTATGTTTCTCGTCTTCCTTTTAAGACGAAGATCAGTCTTACAGAAGAC
  
3' flanking region
GTTAAAGATCACAGCTGCGGAGAAATACCTTCGTTTACATCATATTCTGA
SNP nucleotide
AG
SNPdb format
CTTATGTTTCTCGTCTTCCTTTTAAGACGAAGATCAGTCTTACAGAAGAC[A/G]
GTTAAAGATCACAGCTGCGGAGAAATACCTTCGTTTACATCATATTCTGA
  
Related Markers  

Related Genotyped Markers: These markers have been genotyped and share a name with this marker

Genomic location of solcap_snp_sl_8655  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D26071 marker 26071
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)