SGN Marker TG6

SGN-M261

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
600
Vector
pUC
Cutting Site
EcoR1/HindIII
Drug Resistance
AMP
Image
TG6 image not available
Forward sequence
TACTTCAATAATTACATGGAAAATGCTTCTACAACTTCCAATGTCAATGGGAAAATATGGGCGTTAAAAACCAAGAATATGATATTGCCG
TAATTAGGGATACCCAACTAAAAATAGATCTTAATATGAAACCCGAATTATGCCTTATAACTTTTACATCACCATTGTGTATGCTAAATG
TATTGTAGAACAACCATTTGCATTATGGAATGATATTTGTGAATTGGCAGAAGACATTAATAAACCTTGGTTAGTTGGGAATGATTATAA
TGTGATGATGAATTTTGAAGAAAAGATAACGGGGTCTCCCAATCATAGATGCAGATCATGAAGATTTTGAATGTCGCATTTTGAATTGAG
AGTTAACATAACTGTCCTCCAAAGGTAATCTGCTCACATGGTGGAGTGGTAGAGCTGATAATGA
Reverse sequence
TGGTTTTCTGAAACCCATTCAAGATAGTAGATACATCAATAATTACATTGAAAATGCTTCTAGCAACTTCCAAATGTAATGGGAAAATAT
GGGTGTTTAAAAACCAAGAATATGATATTGCCGTAATTAGGGATACAAAACAAAAAATAAATCTTAATATGAAACACAAATTATGCCTTA
TAACTTTTACATCACCATTGTGTATGCTAAATGTATTGTAGAACAACAATTTGCATTATGGAATGATATTTATGAATTGGCAGAAGACAT
TAGTAGACCTTGGTTAGTTGGGAATGATTATAATGTGATGATGAATTTTGAAGAAAAGATAAGGGGGTCTCCCAATAGTAGATGCAGATC
ATGAAGATTTTGAATGTTGCATTTTGAATTGTGAGTTAACAGAAGTGTCCTCCAAAGGTAGTCTGTTCACATGGTGGAGTGGTAGAGCTG
ATAATGATTGTATCTTTAAAAGAATTGAACA
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato-EXPEN 1992   
Map version
28 (location: 8751)
Chromosome
1
Position
18.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG6 was used as an overgo probe on plate 14 [well A6]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P254O16,   P120B04,   P034I06,   P190C20,   P138D18,   P175K09,   P192B24,   P271F22,   P120P21,   P190E18,   P020N06,   P008E13,   P249N23,   P309L02,   P169H19,   P137B07,   P086D22,   P155J07,   P011L11,   P163N20,   P134P01,   P270I23

 Overgo Sequences

A sequence
CTGTCCTCCAAAGGTAATCTGCTC
B sequence
TACCACTCCACCATGTGAGCAGAT
AB sequence
CTGTCCTCCAAAGGTAATCTGCTCACATGG
Marker sequence
TACTTCAATAATTACATGGAAAATGCTTCTACAACTTCCAATGTCAATGG
GAAAATATGGGCGTTAAAAACCAAGAATATGATATTGCCGTAATTAGGGA
TACCCAACTAAAAATAGATCTTAATATGAAACCCGAATTATGCCTTATAA
CTTTTACATCACCATTGTGTATGCTAAATGTATTGTAGAACAACCATTTG
CATTATGGAATGATATTTGTGAATTGGCAGAAGACATTAATAAACCTTGG
TTAGTTGGGAATGATTATAATGTGATGATGAATTTTGAAGAAAAGATAAC
GGGGTCTCCCAATCATAGATGCAGATCATGAAGATTTTGAATGTCGCATT
TTGAATTGAGAGTTAACATAACTGTCCTCCAAAGGTAATCTGCTCACATG
GTGGAGTGGTAGAGCTGATAATGA
Genomic location of TG6  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D261 marker 261
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)