Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

SGN Marker solcap_snp_sl_9447

SGN-M26169

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2000   
Map version
145 (location: 66330)
Chromosome
11
Position
37.19 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 62500)
Chromosome
11
Position
4.78 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CAGCCCAGTTTGTCGTGAGGATCTGATATGTCTTCCTCCAAAGGTGGCAG
  
3' flanking region
TAGTTTAGGAAATATCGGTCCTCTAGTGATCTGCACGAAAGTAAGCAACA
SNP nucleotide
CG
SNPdb format
CAGCCCAGTTTGTCGTGAGGATCTGATATGTCTTCCTCCAAAGGTGGCAG[C/G]
TAGTTTAGGAAATATCGGTCCTCTAGTGATCTGCACGAAAGTAAGCAACA
  
Related Markers  

Related Genotyped Markers: These markers have been genotyped and share a name with this marker

Genomic location of solcap_snp_sl_9447  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D26169 marker 26169
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)