SGN Marker TG295

SGN-M262

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1500
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG295 image not available
Forward sequence
GCTTGCATGCCTGCAGATGACCAGAATAGTCAAGAGGCTACATATAACCCTATAGCAATAACCTCACATGAGGAAACACATCTCAATCAT
AACTACTCAGAGAAACCTAGATGAATAATTTATCACATAAGCTACTATTATGTAGCGACAAAATGGACTTCTATATAATGAATACTGCAC
CTCAGACAAGAAAGCAGAAGAATCTACAAATGTGTCACCATCACAATAAATGGGAAATGGCATAGGCAATACATTTGGGGAACACTATCA
AAGAAAAGGTACACTACTTGTAATACTGCAAAGGGTCCAATTCAAAAGCAGACAGCAAGGGCT
Reverse sequence
TGTCTCTTTCGTTAGTGGAAATTTGAAAAAAGGAAGAAGAAAGAGGCTCTCAATCTTCAGTATGGTAAGCTATGTGTTGTCTTTATCTAT
TGGCAGTGCTTTCTTGAAGTGGTGCTAAGAAATAGGAACTTGTGTATTGAAAATCTTGAACTTCTTGTTTTTGCTATTTTACAGGATTTG
TTTAGGCAGGCTATTCTTCGACAAGGGCCACCTGAAGAATTCGCTCTTCTAACTGTTCAAGAAGCTATAAAACCTCAGGTTTCTATATAC
ACCCTTTTATCTTTTCTATGTGTGTGCCCTAATTTCTTGATTTCGTAAAACACAACACAAACAAATTCCTGAGATTGTTACTTCCAAGAA
AAGAACTAAATCTCTTCTATATGTGTGCCCTAATTTCTCTTGCACAAAGAAATTCCTTACAAGAAAAGAACTAAGCTATACAAAGTTGTC
CTACTTTATGTTTTGCATAAAACTGCTTCAAGATTGTGTAAA
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1542351.2e-2965 (13.2% of RFLP seq)-
SGN-U1542353.3e-3985 (17.3% of RFLP seq)-
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39983)
Chromosome
1
Position
92.70 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8752)
Chromosome
1
Position
70.40 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG295 was used as an overgo probe on plate 3 [well G5]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P320K06,   P080J18,   P025H01,   P316N21,   P329B17,   P076E08,   P185G24,   P050P19,   P249M15,   P160N24,   P234D05

 Overgo Sequences

A sequence
TTGCATGCCTGCAGATGACCAGAA
B sequence
TGTAGCCTCTTGACTATTCTGGTC
AB sequence
TTGCATGCCTGCAGATGACCAGAATAGTCA
Marker sequence
GCTTGCATGCCTGCAGATGACCAGAATAGTCAAGAGGCTACATATAACCC
TATAGCAATAACCTCACATGAGGAAACACATCTCAATCATAACTACTCAG
AGAAACCTAGATGAATAATTTATCACATAAGCTACTATTATGTAGCGACA
AAATGGACTTCTATATAATGAATACTGCACCTCAGACAAGAAAGCAGAAG
AATCTACAAATGTGTCACCATCACAATAAATGGGAAATGGCATAGGCAAT
ACATTTGGGGAACACTATCAAAGAAAAGGTACACTACTTGTAATACTGCA
AAGGGTCCAATTCAAAAGCAGACAGCAAGGGCT
Genomic location of TG295  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D262 marker 262
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)