Notice: The website will be down for maintenance on Aug 18th (Sunday).

SGN Marker solcap_snp_sl_9553

SGN-M26226

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 74518)
Chromosome
11
Position
40.71 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 70035)
Chromosome
11
Position
41.47 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 62557)
Chromosome
11
Position
5.65 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GCAGGTAAGCAAACATGCAGTTGATGAAGGTGCGTAGAACACTGCTTGGT
  
3' flanking region
CTCTGTCCTTCCAATTTGCCTGGCTTTGAGATGCCAATGGTGGATAAAAC
SNP nucleotide
AG
SNPdb format
GCAGGTAAGCAAACATGCAGTTGATGAAGGTGCGTAGAACACTGCTTGGT[A/G]
CTCTGTCCTTCCAATTTGCCTGGCTTTGAGATGCCAATGGTGGATAAAAC
  
Genomic location of solcap_snp_sl_9553  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D26226 marker 26226
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)