SGN Marker TG7

SGN-M263

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
900
Vector
pUC
Cutting Site
EcoR1/HindIII
Drug Resistance
AMP
Image
TG7 image not available
Forward sequence
ATGGTATAATGAAAAAGGGTATACATTTCAATGAGACTTTTTCCGCAGAGATCACAATGACCACTATGAAATGTTTGCTATCCATTGCAG
CCAATAAGAATTGCGAGATTTCTCAATTGGATGTAAACAATGCCTTCTCACTGAGAGATTTGCGAGAAGAAGTTTACCTGAAGTTGTCCA
GTGTAGATACTCCTAAAGCTATTCTAGCTTGGAGCTACACAAATTTTTATATGGTCTCAAGTAAGCACTCTACGCAATGGTATGCCTGAC
TTGCAGGGCCCTCACTTTCATAGGTTTTATTGCCTCTCAAAATGATTATTCTCTTTTGTTTAACATAGTATGCTATACTACGCTATTTTG
GCTGTTT
Reverse sequence
TGGATTACAGGTGAAGCAATATGCTGATGAGACACTTAACAGACTGAAAGCAAGTTTAGTGATCAGGGATGGTATAATGAAAAAGGGTAT
ACATTTCAATGAGACTTTTTCCACAGTGATCAAAATGACCACTATCAAATGTTTGCTAGCCATTGCAGCCAAGAAGAATTGCGAGATTTC
TCAATTTGATGTAAACAATGCCTTCTCACTGAGAGATTTGCGAGAAGAAGTTAACATGAAGTTGTCAAGTGTTGATACTCCTAAAGCTAT
TCTAGTTTGAAGTTACAGAAATTTTTATATGGTCTCAAGTAAGCCTCTAGGCAATGGTATGCCTGACTTGCAGGGCCCTCAGTTTCAAAG
GTTTTATTGCCTCTCAAAATGATTATTCTCTTTTGTTTAAGAAAGTAGGTTATACTACGCTATTTTGGTTGTTTATGTTGATGATATACT
GATAACTGGAGATATTTACACAATGATAGAGTACCTAAAGATCTTTCTTAATTCAGAATTTATGATCAAGAGTTTTGGTCCTTGTATTAC
TTTCTTGG
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato-EXPEN 1992   
Map version
28 (location: 8755)
Chromosome
11
Position
30.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG7 was used as an overgo probe on plate 10 [well B6]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
ATGGTCTCAAGTAAGCACTCTACG
B sequence
GTCAGGCATACCATTGCGTAGAGT
AB sequence
ATGGTCTCAAGTAAGCACTCTACGCAATGG
Marker sequence
ATGGTATAATGAAAAAGGGTATACATTTCAATGAGACTTTTTCCGCAGAG
ATCACAATGACCACTATGAAATGTTTGCTATCCATTGCAGCCAATAAGAA
TTGCGAGATTTCTCAATTGGATGTAAACAATGCCTTCTCACTGAGAGATT
TGCGAGAAGAAGTTTACCTGAAGTTGTCCAGTGTAGATACTCCTAAAGCT
ATTCTAGCTTGGAGCTACACAAATTTTTATATGGTCTCAAGTAAGCACTC
TACGCAATGGTATGCCTGACTTGCAGGGCCCTCACTTTCATAGGTTTTAT
TGCCTCTCAAAATGATTATTCTCTTTTGTTTAACATAGTATGCTATACTA
CGCTATTTTGGCTGTTT
Genomic location of TG7  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D263 marker 263
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)