SGN Marker TG8

SGN-M265

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
800
Vector
pUC
Cutting Site
EcoR1/HindIII
Drug Resistance
AMP
Image
TG8 image not available
Forward sequence
TTTTTTTTTCAGAATTGATCACAAAATCACTGTGATCCAACTTTGGTTTTTCTCTTTTATGTGCAGAATGTTGTGTTTTTATCTGATTTC
TCTCCACTAAATCAGTTTCCCACTCAAAGTCCCAGGAGAAGATTTTCCAAGAAAATTGTTTCTATGATCACACAACCAAGTTCAAGAATG
CCTGCCACCACTGGCTCAGTTGAGTTTATATTGTTTTCTATCACATACCTATGCGTGTGGCTTAGTGATCAATGAAGTAACTTGATAAGT
TTATTGTTCAAACTCTAGCACAAACAAAAACAATAGGTGATCTCTTTCTATCTGCCCTACCCTTGGTTGACAGACTTAGCTGATATGTGA
CGTTGGTCGGAGGAAATAAGTATCCCGTAGATTTAGTTGAGGTGCGCAAAAGCTGGCCTAGACACCACAGTTATAAAAAAAATACTAGGT
GATTTCTTCCATTGTCTTAGTCTTAGTGGACAGAGTTACATGTTACTAGTGGGAGGTGACAAGTATCCCATGAAACTAGTTGAGGTGCGA
GAAAGTTGACCT
Reverse sequence
CACTTCTCCCCATAGTCATAAACTCTTCACCTAAAAAAACAAAAAAATCACAATCACAAGCATCAAGTACCATTAAGCTATATGGAAAGT
TTGCAACTTTATTCCCCAAATATGAAAAGGGGAATTATTTTATTATCATCGCGGTGTCTAGGTCAACTTTCTCGCACCTCAACTAGTTTC
ATGGGATACTTGTCACCTCCCACTAGTAACATGTAACTCTGTCCACTAAGACTAAGACAATGGAAGAAATCACCTAGTATTTTTTTTATA
ACTGTGGTGTCTAGGCCAGCTTTTGCGCACCTCAACTAAATCTACGGGATACTTATTTCCTCCGACCAACGTCACATATCAGCTAAGTCT
GTCAACCAAGGGTAGGGCAGATAGAAAGAGATCACCTATTGTTTTTGTTTGTGCTAGAGTTTGAACAATAAACTTATCAAGTTACTTCAT
TGATCACTAAGCCACACGCATAGGTATATGATAGAAAACAATATAAACTCAACTGAGCCAGTGGTGGCAGGCATTCTTGAACTTGGTTGT
G
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1511754e-0829 (5.3% of RFLP seq)+
SGN-U1685655.7e-72136 (24.6% of RFLP seq)+
SGN-U1511754e-0829 (5.4% of RFLP seq)-
SGN-U1685651.1e-1440 (7.4% of RFLP seq)-
Mapped locations  
Map: Tomato QTL map   
Map version
137 (location: 53852)
Chromosome
9
Position
62.80 cM
Confidence
uncalculated
Protocol
RFLP

Color_a_a9_1Dry_matter_weight_dmw9_1Soluble_solid_content_ssc9_1Titratable_acidity_ta9_1 Color_b_b9_1 Color_L_L9_1Elasticity_ela9_1 3_Methylthio_propanal_content_mta9_1 3_Methylthio_propanal_content_mta9_2 2_Methylbut_2_enal_content_bea9_1 Orthomethoxy_phenol_content_myp9_1 Eugenol_content_eug9_1
Tomato QTL map

Map: Potato meta-QTL consensus map   
Map version
107 (location: 53382)
Chromosome
9
Position
86.48 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_9
Potato meta-QTL consensus map

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8759)
Chromosome
9
Position
89.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 8760)
Chromosome
9
Position
49.70 cM
Confidence
I(LOD2)
Protocol
RFLP


Potato-TXB 1992
Overgo hybridization and physical mapping 
TG8 was used as an overgo probe on plate 14 [well F12]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P176E03,   P128I14,   P270P22,   P260N08,   P212A18,   P047D08,   P248K02,   P283G13,   P231M08,   P112H17,   P179C08,   P108E12,   P139E08,   P021D21,   P251J06,   P285F14,   P297K19,   P176O03,   P306H13,   P076B14,   P114E20,   P004P04,   P080A17,   P139A13,   P138C11,   P288M22,   P240J24,   P150P22,   P246I13,   P105D12,   P174M03,   P304N18,   P110J23,   P005D23,   P272A18,   P171B14,   P184M15,   P101M11,   P329H05,   P216I09,   P081C16,   P213B22,   P092C18,   P161I08,   P270J22,   P101M24,   P149F06,   P145P24,   P279C12,   P093J12,   P095G24,   P317E24,   P157H24,   P038B23,   P208G11,   P079P03,   P155H12,   P168F15,   P257D16,   P024M07,   P244I07,   P264E07,   P064K05,   P163J23,   P124M14,   P257P15,   P005J17,   P151P01,   P310A21,   P315H06,   P176P11,   P110H09,   P145N22,   P249G23,   P099H20,   P089D15,   P163E13,   P161F24,   P113E18,   P011K19,   P308E15,   P141C05,   P015M17,   P022A07,   P107O13,   P183N12,   P003E23,   P275K05,   P152L18,   P075C11,   P108J20,   P158K07,   P212H22,   P309B03,   P117F02,   P216K12,   P282I23,   P307J13,   P084P13,   P261M08,   P287D14,   P285G17,   P270N08,   P070P02,   P141E11,   P276B16,   P070F06,   P122F17,   P076M05,   P128P09,   P298I07,   P004I18,   P059D21,   P163N16,   P283P11,   P021I18,   P036I12,   P212M03,   P006A24,   P187E02,   P100I06,   P234G07,   P007J14

 Overgo Sequences

A sequence
TTAGTTGAGGTGCGCAAAAGCTGG
B sequence
AACTGTGGTGTCTAGGCCAGCTTT
AB sequence
TTAGTTGAGGTGCGCAAAAGCTGGCCTAGA
Marker sequence
TTTTTTTTTCAGAATTGATCACAAAATCACTGTGATCCAACTTTGGTTTT
TCTCTTTTATGTGCAGAATGTTGTGTTTTTATCTGATTTCTCTCCACTAA
ATCAGTTTCCCACTCAAAGTCCCAGGAGAAGATTTTCCAAGAAAATTGTT
TCTATGATCACACAACCAAGTTCAAGAATGCCTGCCACCACTGGCTCAGT
TGAGTTTATATTGTTTTCTATCACATACCTATGCGTGTGGCTTAGTGATC
AATGAAGTAACTTGATAAGTTTATTGTTCAAACTCTAGCACAAACAAAAA
CAATAGGTGATCTCTTTCTATCTGCCCTACCCTTGGTTGACAGACTTAGC
TGATATGTGACGTTGGTCGGAGGAAATAAGTATCCCGTAGATTTAGTTGA
GGTGCGCAAAAGCTGGCCTAGACACCACAGTTATAAAAAAAATACTAGGT
GATTTCTTCCATTGTCTTAGTCTTAGTGGACAGAGTTACATGTTACTAGT
GGGAGGTGACAAGTATCCCATGAAACTAGTTGAGGTGCGAGAAAGTTGAC
CT
Genomic location of TG8  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D265 marker 265
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)