SGN Marker TG440

SGN-M267

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1300
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
TTTAGGTTATTTACGAGCGGCGCAAAAATTGATTTGATCGATAAATTGTATTGGAAAAATATTATATATTTATTGATTTTAGGTTGTTTA
GTTTTAAATGATTTTGTAAGTACTTTTATTGGATTATCAATTTGATTTTTGATTTATATGATTTTGATTAATGATTAAATTGATAAATCA
ATGAGATTAATTAAATTAAAATTATTATTTTACTCCTAATTATCTTACCATGAATATAACATTTTGTCCATTATTTCTAAATGTTAGTAT
TACTTCCGGCCATAGATAACACACACAAGCCCCTCAATCCCTCTTTGACACTTTTTTTTTCCGAGACACAAAATAGTATTATTTTTTGTC
TTCTCAATTTTAAATTTGATTGTAATCAAGACAAACAATTAAAGTTGTTTTATGAGTATTTAAATGAGTCTTTAGATGGAATTTGAACAA
TTATGTTTTAGATGGAAGTGATTAGTGTAGAAATTCGTATTGCAATTTA
Reverse sequence
AGGGAGACAAGCTTGCATGCCTGCAGCTCTAGGGTCTGCATACACTCTAGCCTCCCCAAACTCTCAGTTTGATGGTGAATTTGAAATAGT
CGATTTAACTATCACAATCGTACACACTTGATCCTAAAAAATATTCACAATGCATAGAGAGACCTAATAAAAAGCTCATAAAATCTACAA
ACAACTCAACTTTTACATACATTTTGATAATCAACCAAGTCCGAGTGTAATATAACTCTATAACATTCACAAAAATCATTCGTATAAATA
AAAAGTTTGATTTTAGAATTCGATGTAATGCAGTTCAAGCATTGATCAAAGCACCGAAAAATTCATCATTACTTACAGAATCAGAGAAAT
GAACCAAACGATTCATCTAAAGCATCAACTTTCAATGATTTTGTTCATCCATGAAGCTGCTGCTGAAGAAATTGTGGCTTTTGATTATCC
GTTGGGAGTTTTGTTTGGGAGAAGAAAATGTTTAAAAGTGGAGAAAGAACCCTAATTTGCGCAG
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1685111.3e-72137 (26.7% of RFLP seq)-
Mapped locations  
Map: Tomato-EXPEN 1992   
Map version
28 (location: 8764)
Chromosome
1
Position
95.60 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG440 was used as an overgo probe on plate 14 [well F9]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P319P24,   P055O09,   P261N08

 Overgo Sequences

A sequence
AGGTTATTTACGAGCGGCGCAAAA
B sequence
TATCGATCAAATCAATTTTTGCGC
AB sequence
AGGTTATTTACGAGCGGCGCAAAAATTGAT
Marker sequence
TTTAGGTTATTTACGAGCGGCGCAAAAATTGATTTGATCGATAAATTGTA
TTGGAAAAATATTATATATTTATTGATTTTAGGTTGTTTAGTTTTAAATG
ATTTTGTAAGTACTTTTATTGGATTATCAATTTGATTTTTGATTTATATG
ATTTTGATTAATGATTAAATTGATAAATCAATGAGATTAATTAAATTAAA
ATTATTATTTTACTCCTAATTATCTTACCATGAATATAACATTTTGTCCA
TTATTTCTAAATGTTAGTATTACTTCCGGCCATAGATAACACACACAAGC
CCCTCAATCCCTCTTTGACACTTTTTTTTTCCGAGACACAAAATAGTATT
ATTTTTTGTCTTCTCAATTTTAAATTTGATTGTAATCAAGACAAACAATT
AAAGTTGTTTTATGAGTATTTAAATGAGTCTTTAGATGGAATTTGAACAA
TTATGTTTTAGATGGAAGTGATTAGTGTAGAAATTCGTATTGCAATTTA
Genomic location of TG440  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D267 marker 267
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)