SGN Marker TG513

SGN-M268

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1300
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
AAGAAAACTAACAACACGTAAACGCAACCAAAAGCAGTATACTCTACGCGTATAGAATTCAAGCTTAGTAGAATCAACCACCTTGTATAA
AGGAGCACACATGCTACGAAATAGACTGCGTATAAGAAAGAAACGGCTTGAACGATAGATGATGTTAAAAGGACATAGACATATGAGAAC
TAAGCCCTGCATTTGAATGAGAGGATTTGATCAAACAAAATGTGAAGTGACAGTGTGCTCAACTTTATATATAAAATCTTACAATGAGCA
AGCCCAAAGGAACCAGTTCGACAAATGTCTCATGCTCTTGGATCCTCGAGTCCATCCGGATATGCAGTTGTACCAGGCAAGCAGTGAGTA
CAAGAACTGCAAGACCAGAGGCTAAGAGAAAAACTTCCTTGTGATCTAACTCGGTTCCTGGCTTGAATCCAAGTATAAACGAGTAGTTGA
TTCTATA
Reverse sequence
GGAGACAGCTTGCTGCCTGCAGATTACTTCAAGGAAAGTGATGAGATCATACATGAAAATCGTGGATAACTCCTATATTGGAAGTTCTGA
TGAGGTATATTAAAAGAACTCTTAATATATAACTCTGAGAAGTATGATCTTACAAAGACGAAAACTAGTATAAGATGGAAATTATTTTAT
TACAACCTTAAACTTGCATGTCTTGTCTCCAAGATTTGTTATATGCACACTATTATATATTCACTTAGTTTATTTTTTTCATGTTCTAGG
TTACTGGTCTTCTGAACAAGGTAGAAGCAACAATTGTCAAGCACTTCAATTCTGGACGGGGGGACGACATCAGATTAGTAAGGCCGGAAA
GGAAAAGAGAGAAACACAGCATTTGGTTTCTTTCAGGTTGAGAACTTCTCCTTTGTTAAAGATTTTACTTCATAGTTTTCGACATCTCTT
TAACTTGTAAATTCATAAGATCTTGCTGAGGAAGAAGATGGGGTTA
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Eggplant-COSII   
Map version
63 (location: 42480)
Chromosome
8
Position
49.20 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40071)
Chromosome
8
Position
32.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000

Map: Pepper-AC99   
Map version
34 (location: 8769)
Chromosome
8
Position
60.16 cM
Confidence
uncalculated
Protocol
RFLP


Pepper-AC99

Map: Eggplant-LXM 2002   
Map version
29 (location: 8766)
Chromosome
8
Position
34.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8765)
Chromosome
8
Position
33.20 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG513 was used as an overgo probe on plate 13 [well A4]

Plausible BAC Matches:   P108G06

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
TCCATCCGGATATGCAGTTGTACC
B sequence
TACTCACTGCTTGCCTGGTACAAC
AB sequence
TCCATCCGGATATGCAGTTGTACCAGGCAA
Marker sequence
AAGAAAACTAACAACACGTAAACGCAACCAAAAGCAGTATACTCTACGCG
TATAGAATTCAAGCTTAGTAGAATCAACCACCTTGTATAAAGGAGCACAC
ATGCTACGAAATAGACTGCGTATAAGAAAGAAACGGCTTGAACGATAGAT
GATGTTAAAAGGACATAGACATATGAGAACTAAGCCCTGCATTTGAATGA
GAGGATTTGATCAAACAAAATGTGAAGTGACAGTGTGCTCAACTTTATAT
ATAAAATCTTACAATGAGCAAGCCCAAAGGAACCAGTTCGACAAATGTCT
CATGCTCTTGGATCCTCGAGTCCATCCGGATATGCAGTTGTACCAGGCAA
GCAGTGAGTACAAGAACTGCAAGACCAGAGGCTAAGAGAAAAACTTCCTT
GTGATCTAACTCGGTTCCTGGCTTGAATCCAAGTATAAACGAGTAGTTGA
TTCTATA
Marker Submitted By 
Name: Molly Jahn
Organization: Cornell University
Genomic location of TG513  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D268 marker 268
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)