SGN Marker TG515

SGN-M269

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
2500
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG515 image not available
Forward sequence
AGAGGGTTGCACCTATATGGATATGAATCTTTAGTTTGTACTAATATAAATGAATTGTTGAAGCGTGACTTGCACAAAAAGATATTTAAA
ATCATTAATTAAAAAGTAATCTATCAATATAAAATAGTGTCAATAATCCGTTTATTTTGGATTAGAGGGAGTAATCCACTCATATGTTAT
TAGTTTTATCGTTTCATGTAGATAAATAGTCACCCAACACGATTAATGTGTGCCTAAAATAATGTTTTATATACCATATCAATAATAACA
TATTTAACTTAGGAAAACAGTCCCAAAACATGTTTTATTTGTGTGCTACAAATAAAGTTTTACTATGTCAACATCAAAATGTTTAATGCA
GGAGAATAGTCACAAAAACATGATTTGCATAATTCAATAATAGGAAAAAGACAGAAAATAGGGCTAATTAGTGAAGAGATTAACAAAAAT
TAG
Reverse sequence
GGAGACAGCTTGCATGCCTGCAGTGCAACAATTAACACTCACTCGATTAAGTTTGGCCAATTTAGAAGATGGACAAATCATGTATGCAAC
TCTAGGGTCACATTCCAGGGTACGTACATACCTTGGGTTCATCACTCTCTCCTTCACAAACAAACTTGCCATTTTTACCGAAATAGTAGC
AACCTTTGTATCCCGTGCAACACGTGGTACATCCAGTGGGATAAATAAACGTCTTTCCTCCTGAACGGGGACACTTTGAATAGGCAATAT
GTGGATCACAATTTCGAGGGCAAGCTTTTGGGTTTCTAGGGTCAGATTGTCCTTCACAAATAAAAGTTCCATGAGCACTATAATAATTGC
AACCTTTAAAACCTGCACAACAGTTTGTGCATATGGGATTTTGCGGACTTCCTTGTGAACGTGGGCATATCCCAAACCCAAGATGACCAC
ATTCCTTAGTACAAGGCTTGGCATCAACATGT
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1461038.6e-0681 (16.8% of RFLP seq)-
SGN-U1461033.5e-0849 (10.2% of RFLP seq)-
SGN-U1604701.6e-1679 (16.4% of RFLP seq)-
SGN-U1549551e-17173 (35.9% of RFLP seq)-
SGN-U1549551.1e-2395 (19.7% of RFLP seq)-
SGN-U1433282.8e-2793 (19.3% of RFLP seq)-
SGN-U1433322e-74449 (93.2% of RFLP seq)-
SGN-U1433299e-83390 (80.9% of RFLP seq)-
SGN-U143331466 (96.7% of RFLP seq)-
Mapped locations  
Map: Tomato-EXPIMP 2009   
Map version
126 (location: 53564)
Chromosome
3
Position
54.59 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2009

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8771)
Chromosome
3
Position
61.10 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG515 was used as an overgo probe on plate 4 [well A9]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
GAGGGTTGCACCTATATGGATATG
B sequence
GTACAAACTAAAGATTCATATCCA
AB sequence
GAGGGTTGCACCTATATGGATATGAATCTT
Marker sequence
AGAGGGTTGCACCTATATGGATATGAATCTTTAGTTTGTACTAATATAAA
TGAATTGTTGAAGCGTGACTTGCACAAAAAGATATTTAAAATCATTAATT
AAAAAGTAATCTATCAATATAAAATAGTGTCAATAATCCGTTTATTTTGG
ATTAGAGGGAGTAATCCACTCATATGTTATTAGTTTTATCGTTTCATGTA
GATAAATAGTCACCCAACACGATTAATGTGTGCCTAAAATAATGTTTTAT
ATACCATATCAATAATAACATATTTAACTTAGGAAAACAGTCCCAAAACA
TGTTTTATTTGTGTGCTACAAATAAAGTTTTACTATGTCAACATCAAAAT
GTTTAATGCAGGAGAATAGTCACAAAAACATGATTTGCATAATTCAATAA
TAGGAAAAAGACAGAAAATAGGGCTAATTAGTGAAGAGATTAACAAAAAT
TAG
Genomic location of TG515  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D269 marker 269
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)