SGN Marker TG444

SGN-M272

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
2100
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG444 image not available
Forward sequence
TTGCATGCCTGCAGATATGTTCAGCATGATATAGAGGGGTTTAGAGTAAGCAACTAAAAATCTCTGTGAATATTTTCTGCTACTTCCCCA
ACTGCTAAACAAGAGTACTCACCGGAACCTGAAAGCAAGAAGTACCATAGTGCTTTTTGAACCGTCAACTTCACACGTTTGGAGTCCTAA
ATAGACAGAAACAGGGACATGTTAACTGGTGAAGATCAGGTGGGGATGCTTTTTCATCCATGGCTTGTGTGACTT
Reverse sequence
CATACTTTGGACAACAAACATGGGATCACAGGCAGATTTTTGAAAGGCTGGGGGATGACAAAAAAGAGGCAAAGTACTCGGAGAGCTAAG
TCTTGTGTGTCTCCTCTTTTCTTAGCTGCTTGAGTAAATTTTAAACTAATGTATTTATAGCCCAGGAAGTTGACGGCTAGGCTTTTCTTC
TCTTTTTTCTAGCACTGTTGAAGATATTAT
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1552662.3e-2667 (26.3% of RFLP seq)+
Mapped locations  
Map: Tomato-EXPEN 1992   
Map version
28 (location: 8781)
Chromosome
6
Position
50.50 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG444 was used as an overgo probe on plate 4 [well E8]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P242K07,   P099M15,   P256F18,   P315H19,   P218M05,   P056L19,   P145D05,   P153E11,   P265J09,   P312G04,   P236L18,   P036F18,   P099L14,   P298M12,   P153E10,   P102K16,   P278N13

 Overgo Sequences

A sequence
TCCCCAACTGCTAAACAAGAGTAC
B sequence
TTTCAGGTTCCGGTGAGTACTCTT
AB sequence
TCCCCAACTGCTAAACAAGAGTACTCACCG
Marker sequence
TTGCATGCCTGCAGATATGTTCAGCATGATATAGAGGGGTTTAGAGTAAG
CAACTAAAAATCTCTGTGAATATTTTCTGCTACTTCCCCAACTGCTAAAC
AAGAGTACTCACCGGAACCTGAAAGCAAGAAGTACCATAGTGCTTTTTGA
ACCGTCAACTTCACACGTTTGGAGTCCTAAATAGACAGAAACAGGGACAT
GTTAACTGGTGAAGATCAGGTGGGGATGCTTTTTCATCCATGGCTTGTGT
GACTT
Genomic location of TG444  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D272 marker 272
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)