SGN Marker TG446

SGN-M277

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1000
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG446 image not available
Forward sequence
TTGCATGCCTGCAGCAAACTTCCAAGGCCGGCATTCATATCCATTATATTTCTATACCTCCCATTGTCGAGGATCTTATTAACTCTCTTA
TAAGAATTCACGTGTATTTTCCATAACTTGTTGTCCTCCTTGAATGCCTCAACAGAAAATCCAGGAACAGATCCACTTGCTATTCTCGGA
GGAACAGTATTAAGTCTATCAGGAAACGGCTGAAGTCCCCCACCCGCAACTTCATCTGAATTAGTTGTCTCAGGATAAGGAGTTATGCAT
GCCTCCATCTTCTTATACCTGAGGCCCCAGGATATT
Reverse sequence
GAACATGATTCTCGTGTAACTCTATGTGAATCCTCGAATGCAGCAAATGTCTGGTAAATTCTTGCACCTAATAATCGGTTATCTAATCAA
GATTTCCGAATTTCAAATAGCCATAGTGTAGGAGATTGTCTTCTTTCTTCCTTCTTGTTCAGTCAATGCATATATGAAGTTTCAAGTACT
TGCTTTGTAATTCTAGTTACTTCAATTCACAGAATATTTTGAGTTATGCAGCAATTTGATTACATACATTTATGTGAATGTTGTTTCTTG
CTGCCATGTTCTGGTCTTATATTGACAAGCATGTTTAATACTACCTGGAGTTGCTCATTATGGTTTGAATGTTAAAAACAACGATGCCTC
AGTCCCAAACAAGTTTCGGCTATGTGAATCCTCAGTGATCTT
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato-EXPEN 1992   
Map version
28 (location: 8797)
Chromosome
6
Position
46.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG446 was used as an overgo probe on plate 5 [well F4]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P021H17,   P098A14,   P281P06,   P184I15,   P302O08,   P063K01,   P219C14,   P313J22,   P297I23,   P181G10,   P147C13,   P261K17,   P073B09,   P297I21,   P164N03,   P173M13,   P011A01,   P117H21,   P161K19,   P066F05,   P334D13,   P010K23,   P251K01,   P311K08,   P332I07

 Overgo Sequences

A sequence
CATGCCTGCAGCAAACTTCCAAGG
B sequence
TGGATATGAATGCCGGCCTTGGAA
AB sequence
CATGCCTGCAGCAAACTTCCAAGGCCGGCA
Marker sequence
TTGCATGCCTGCAGCAAACTTCCAAGGCCGGCATTCATATCCATTATATT
TCTATACCTCCCATTGTCGAGGATCTTATTAACTCTCTTATAAGAATTCA
CGTGTATTTTCCATAACTTGTTGTCCTCCTTGAATGCCTCAACAGAAAAT
CCAGGAACAGATCCACTTGCTATTCTCGGAGGAACAGTATTAAGTCTATC
AGGAAACGGCTGAAGTCCCCCACCCGCAACTTCATCTGAATTAGTTGTCT
CAGGATAAGGAGTTATGCATGCCTCCATCTTCTTATACCTGAGGCCCCAG
GATATT
Genomic location of TG446  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D277 marker 277
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)