SGN Marker TG448

SGN-M278

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1500
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG448 image not available
Forward sequence
CCTCAAACATCATTCAGGGCACAAAAAAAAAATCCGTGCATAGTCTATGGATTAAGTACATCTTTTAACATCAACCAAACCAGCTGCTAA
ATTTTACCCTTATACGTTGAATAGAACCCACCTCAGCCTCATCATTATATGCTAAATACTGATGGGATTACTCAAATATCGCAGATGTTG
GAGGAGTAATCAGGGTTCACTGTGGGATATGGTTCCTTGGCTTTGAGCTACTGCAAATTTGTTACGACTGTTTTTTCATGCGGAATTAAT
ATATGATTTTTCAACTTGCTTTGGAATTTTACCTTACTCCTCTAGAAATTAATGTGGATACTACTGAAATTGTCCAGCTATTAACTATTT
TTAACATTTTTGGACCCACCATCATCCCTGTTGGATGTTTTGAATGCTGATGCCATGGTGTGCGTCCGCTAGAGAGATAAATAGAAGTGT
CTTATGACCAGCTGTTGTGTCTAGTTCTAGTTCAACTTCA
Reverse sequence
GCTTGCATGCCTGCAGTTGGTTGTTGCACCGTTGCTGTCTGTTATACACATTTACAGTGTCTGTGAAGAAATGCGAGCTGCTCCTGTCAA
CACATTAAATCCTCAGAGAACTGCAATGATCGTGGCTGATTTTGTGAAGGTACATATCCAATGTTGCAAAGATGAGTTACATCAATTCTT
CACATCACAATTAACTAAGTTTTTCTTCTATAATATTTTAGACTGGCAGAATCTCAAGTCCTGCTGACTTAAGATATCGAGAAGATCTCT
TGTTTCCCGGAAGGCTGATAGAGGATGCTGGAAAGGTTAAGGTGGGAAGGTCCCTGCATGAAGTAGTTAGGCCTTCAAAGCTGAAACAAG
TTTCAAGAATCATTTCTAGAAGAGAAATTCCTTTTGAATCACG
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato-EXPEN 1992   
Map version
28 (location: 8798)
Chromosome
5
Position
42.80 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG448 was used as an overgo probe on plate 14 [well F3]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P211D13,   P160O01,   P286K20,   P279K13,   P228O23,   P210A16,   P289L24,   P109F15,   P136B03,   P289L08,   P265H12,   P028G15,   P248J14,   P263M21,   P309K21,   P283B12,   P309M10,   P160O07,   P295F17,   P199M03

 Overgo Sequences

A sequence
GAGGAGTAATCAGGGTTCACTGTG
B sequence
CCAAGGAACCATATCCCACAGTGA
AB sequence
GAGGAGTAATCAGGGTTCACTGTGGGATAT
Marker sequence
CCTCAAACATCATTCAGGGCACAAAAAAAAAATCCGTGCATAGTCTATGG
ATTAAGTACATCTTTTAACATCAACCAAACCAGCTGCTAAATTTTACCCT
TATACGTTGAATAGAACCCACCTCAGCCTCATCATTATATGCTAAATACT
GATGGGATTACTCAAATATCGCAGATGTTGGAGGAGTAATCAGGGTTCAC
TGTGGGATATGGTTCCTTGGCTTTGAGCTACTGCAAATTTGTTACGACTG
TTTTTTCATGCGGAATTAATATATGATTTTTCAACTTGCTTTGGAATTTT
ACCTTACTCCTCTAGAAATTAATGTGGATACTACTGAAATTGTCCAGCTA
TTAACTATTTTTAACATTTTTGGACCCACCATCATCCCTGTTGGATGTTT
TGAATGCTGATGCCATGGTGTGCGTCCGCTAGAGAGATAAATAGAAGTGT
CTTATGACCAGCTGTTGTGTCTAGTTCTAGTTCAACTTCA
Genomic location of TG448  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D278 marker 278
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)