SGN Marker TG378

SGN-M281

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1200
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG378 image not available
Forward sequence
CTATGCTAAAGCATAGAAGACTCCTATAATAACTCAACAGTAGATTAACAAACAACTGATTAGAACACATGTTAAAGAGAACAAGACCTT
TGGGTGTATCACATGAAGTATGATATGTGAGAGGATTGCTAACAGAAGTTTCAAGATTTGGGATCTCGGGTAATGTTTAATGGCCTTATA
GGAATATGTGGAACCTGTTGATTGCATTGACAATCATTTATCATGTATGGATGAATTTTTTTGTAGTCTCAACTTAATACACTTATCGCT
GAAGTTGCTCATCGTGCAAGAGAAATATTAGGTTTCGCATCTTTTGGCTGATGGAAATTACCAACTAGTTTTATTCTTGAGGAATGTTTC
TCTATTGCAATCTGACTAACATCACGATCACTTTTGACTGAAGTATTGAAACGTGTTAATTGCATTTTCGTGCCCCCTTTGAAATGTTGT
GTCAAAATCAGTGTGAGGTTATATTTTG
Reverse sequence
GGAGACAAGCTTGCATGCCTGCAGTAAGTGACATGAAATCAATATTTGATTTTGAGAGATCTAACAATTGAGGTGCTAAAATGTCATGAA
AAACATAACTACATAATAAGAAACAACTAAAAGTCACTTTAGATATGAATCATTTTCTCCTCTCCAATGCATTATAGCAGCAATATAAAA
GCAAAGGCTAAAACTGCTAAAAATGTGATTACTTTGTGCATACAATAAGTTATATAGACTTCACTTTAGTGATGAACTCTGTAGTCATTA
TTTTAATTCTAAATAACAAAAAAGCGAGCAACTACAAACTGGAAATTATAATACATGACTAACATAGTGAATAAGGGATAAAGAACTTCA
AAAGGTAATTATTTACCAAGTGTTCTAGTTAACTTAGAGCTAATTATTATTAATCACACATCATTAAAGTCTAGCTAATAGGAATTTCAC
ATTCTCTGTGTCTAAGACAAGTCATGTGGATAGTTATTGTATCAACATTTCATGTTCTTATAAGATTTGTAACGTAACTCTTCTAATCAA
TAGAAGGGCACAAAATA
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1644861.1e-60121 (25.3% of RFLP seq)+
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40020)
Chromosome
1
Position
31.80 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8803)
Chromosome
1
Position
22.30 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG378 was used as an overgo probe on plate 5 [well F9]

Plausible BAC Matches:   P252G05,   P112F12

 Overgo Sequences

A sequence
GACCTTTGGGTGTATCACATGAAG
B sequence
CCTCTCACATATCATACTTCATGT
AB sequence
GACCTTTGGGTGTATCACATGAAGTATGAT
Marker sequence
CTATGCTAAAGCATAGAAGACTCCTATAATAACTCAACAGTAGATTAACA
AACAACTGATTAGAACACATGTTAAAGAGAACAAGACCTTTGGGTGTATC
ACATGAAGTATGATATGTGAGAGGATTGCTAACAGAAGTTTCAAGATTTG
GGATCTCGGGTAATGTTTAATGGCCTTATAGGAATATGTGGAACCTGTTG
ATTGCATTGACAATCATTTATCATGTATGGATGAATTTTTTTGTAGTCTC
AACTTAATACACTTATCGCTGAAGTTGCTCATCGTGCAAGAGAAATATTA
GGTTTCGCATCTTTTGGCTGATGGAAATTACCAACTAGTTTTATTCTTGA
GGAATGTTTCTCTATTGCAATCTGACTAACATCACGATCACTTTTGACTG
AAGTATTGAAACGTGTTAATTGCATTTTCGTGNNNNCTTTGAAATGTTGT
GTCAAAATCAGTGTGAGGTTATATTTTG
Genomic location of TG378  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D281 marker 281
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)