SGN Marker TG521

SGN-M282

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1700
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG521 image not available
Forward sequence
CTGCGCAGAAGACGAAAGTCCACCGCCGGCGACCTGAGACGGTGGAGGAGTAGTCACCCCAGGGTTTGGTCTTCCGCGTTTCCGCGATTC
AGTTGTACTGACGGAAGGGTCCGGAAATGAAGGGACCAGAGGAGTCGAGGAGGAGATTGGTTGCGCCGGCGTATTATCGTCGGCGGCGGA
GGTTGATCCCACGTTTTCCATTGATGCTTTGAACTGATTTTTTTCGCTCTATTTTCACTACTCCATCGGTAGTACTGTGCTCTATTTATA
GTTTTCAGAAAACAAAAACCGCTTCATTCAGAATCAAAACAGATTTGGAAATGAATTAATTTAAATCCCATTTTTGAAAAAAACAAAATT
GGTCAAAATTGTGTTAAAAACGTAAAGAATAAAAAATCATTTTGTTTTACTCCTAACGATTTTCTGTGCTATTTAGGTAAAAATGTGATC
ATTTTGTTTTAAATTTTTATTTAGTTACACTTTTATTTCAGTTTATCTAATTTA
Reverse sequence
GGAGACAGCTTGCATGCCTGCAGACATTCCATGTACAAGATAATGCTTGTTAGGTAACACACGTTGTTTCTTTTTCTCATATTTTCTGCT
CTTGGTTTCTTATGCAGACGTGGGTGAGAATGATTCAAGTCATTCAATGGATGAGGATCAAGCAAAAAAATCACCTGCACAGAAACGTAA
AAGGCTCCGAAGGAGTTGTAGGAAAAGTTAGTATTACATTGAAACATGCCGTTTCTTCTTGTGCAGGTATCTTTATCGTATGTATTTGTT
GTCGATATGCAGCGGCTTTTTGTTAGTACAGTCATATGTTGGGAAGAGGTCATAGTGAAATATGTTATTTTGTTGTACACCTTATATCAG
AGAGATGTGCTATGACCGAACACTTGTCTTGAGTTATAAGTTTCAACTAGTACAAGTAAATCAAAGACACATAGATTGATACTTATTTGA
TCACAAATCAAATATGCATAACTGCTAGTAGCTTTTTCTTTTCCCGTTACTGTGAAGATAGTAAGGTAAGTATCTGTTTTTCTTTTTTGG
TAGTA
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1589032.3e-0650 (9.9% of RFLP seq)+
SGN-U1589031.5e-0732 (6.3% of RFLP seq)+
SGN-U1556391e-1464 (12.7% of RFLP seq)+
SGN-U1556391e-1456 (11.1% of RFLP seq)+
SGN-U1589031.8e-2293 (18.5% of RFLP seq)+
SGN-U1641534.6e-2070 (12.8% of RFLP seq)-
Mapped locations  
Map: Tomato QTL map   
Map version
137 (location: 53900)
Chromosome
2
Position
53.10 cM
Confidence
uncalculated
Protocol
RFLP

Dry_matter_weight_dmw2_1 Titratable_acidity_ta2_1 Eugenol_content_eug2_1 Fruit_weight_fw2_1Soluble_solid_content_ssc2_1 Sugar_content_suc2_1 3_Methylthio_propanal_content_mta2_1 Hex_3_en_1_ol_content__x3o2_1 Fruit_diameter_fd2_1 Color_a_a2_1 Dry_matter_weight_dmw2_2 Sugar_content_suc2_2 Soluble_solid_content_ssc2_2 Color_L_L2_1 Fruit_weight_fw2_2Titratable_acidity_ta2_2 Dry_matter_weight_dmw2_3 Color_b_b2_1Fruit_diameter_fd2_2 Elasticity_ela2_1 Carotene_content_car2_1 2_Isobutylthiazole_content_ibt2_1
Tomato QTL map
Genomic location of TG521  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D282 marker 282
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)