Notice: The SGN server upgrade is complete. Please let us know if you find any issues. :-)

SGN Marker TG522

SGN-M283

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
800
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
GGGAGACAGCTTGCATGCCTGCAGGAAGAGCGTACTGGAACCCGACGTTCCTCGACACACCGCAACCACTAGTTTGACTCCTTGTATCAA
TTACGAGAAGAGAGGGTTTTCTTAAGCCAAGTGAAAATTCACTATAGGCATTCAATTTGGATGGTATAGTGCGAGGTTGGAGATTTTATC
TGTATCTCACTCCTCGTATCATTCAAAATTTTAAGATATTTTCCCTTGTGTTTTCATGCTTGCATGTACAAGCAGTGGTCATCTTTTACC
AGGTCGCCATGTGACAGCCATTTGAACTTTTGCTTTTTGTAATTTTAGTGTTTTTTGGCATGAAAAATTTGGGTGCTACTTCATTTGTCT
ATTGACATCATAACAGAGGAGTGATTACTACCAAATATTCTTCTATTCTGATTTTCATGTTTTGGTGTGTGATTTGCCTTTTTATTACAT
TATTTAGATACCTT
Reverse sequence
ATGCAACTAGCTGTATAAAATAGTTGTTAGATAAATACCATGAAGTTGAAAACATCACTTCCAATAGATTAAGGATAAGTCCGAACACAG
ATGAAGAGCTAACTCGGATTAATATTGAAAAAGGTAACAGTGTATTCATCAACCCAAAGGTTGTGCTGAAATTCATAATTACATATCCAG
AAGTACAACCTGTCCTTGTTCTTCTTACAAGGATTCTAAATACTGTAATAAAAAGGCAAATCACACACCAAAACATGAGAATCAACGATA
AGTCTGAACACAGATGAAGAGCTAACTCGGATTAATATTGAGAAAGGTAACAGTATTCATCAACCCAAAGGTTGTGCTGAAATCCATAAT
TACATATCCAGAAGTACAAAGTGTCCTTGTTATTCTTACAAGGTATCTAAATAATGTAATAAAAAGGCAAATC
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato-EXPEN 1992   
Map version
28 (location: 8806)
Chromosome
2
Position
0.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG522 was used as an overgo probe on plate 15 [well G8]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P093M16,   P208B01,   P053D23,   P170C01,   P238G24,   P024L15,   P153A13,   P203E15,   P246B20,   P170G11,   P135G10,   P281K14,   P289M06

 Overgo Sequences

A sequence
GCTTGCATGTACAAGCAGTGGTCA
B sequence
GCGACCTGGTAAAAGATGACCACT
AB sequence
GCTTGCATGTACAAGCAGTGGTCATCTTTT
Marker sequence
GGGAGACAGCTTGCATGCCTGCAGGAAGAGCGTACTGGAACCCGACGTTC
CTCGACACACCGCAACCACTAGTTTGACTCCTTGTATCAATTACGAGAAG
AGAGGGTTTTCTTAAGCCAAGTGAAAATTCACTATAGGCATTCAATTTGG
ATGGTATAGTGCGAGGTTGGAGATTTTATCTGTATCTCACTCCTCGTATC
ATTCAAAATTTTAAGATATTTTCCCTTGTGTTTTCATGCTTGCATGTACA
AGCAGTGGTCATCTTTTACCAGGTCGCCATGTGACAGCCATTTGAACTTT
TGCTTTTTGTAATTTTAGTGTTTTTTGGCATGAAAAATTTGGGTGCTACT
TCATTTGTCTATTGACATCATAACAGAGGAGTGATTACTACCAAATATTC
TTCTATTCTGATTTTCATGTTTTGGTGTGTGATTTGCCTTTTTATTACAT
TATTTAGATACCTT
Genomic location of TG522  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D283 marker 283
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)