SGN Marker TG524

SGN-M284

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
800
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG524 image not available
Forward sequence
GCCATAGCAGCGAAGTCATTAATAATTGGAGAGACGGTATATATCGAATATCAACTTGGCTGGACGTATTGATGTCAGCAACAACCAACT
AAACAAAATATTTCCATTTGCTTCAACAAATATGGCAAGAAAGAGTGACAGATCATCTCGAAATTGTTTGGCTTGATGTAGGAAAATAGA
AGAAAAAAAAAGAAAAGAACAGATCTTCAAATGGAAGATGGGAGAAACTTTCCTTCTTTCCCTTCTTTTTCCTTTTCAAAGCAAGGATTA
TTTCCGCATAAAAGATGTTTCCATGGACTTAGTATATTCATATTACCAGGTGGTTGAGGGCGGGAAGCTGTGAAGTCGAGAGCTAGAAGT
ATACATTATTAATTTATAGATGTCTGGTTCATTTCAAACAATTACACAATCAATTTTTACTAAAGTTCCATTTCCCAAGTGTTTTTACAC
ATCCGTTGTCTCATTCATAGAAAATATCTATCAACTGAATGAATACA
Reverse sequence
GGAGACAAGCTTGCATGCCTGCAGTTCTTAGGATAATTGTCGAGAGCAACATTCTTTACAGCTCCTTCTTTTGCTATGTATACTTCTTAT
AAAAGAGGCAGCCCTGTGCACAAAACATCCTGCATTAGCTGGGTCAGGGGAAGGGTCGCAACCTAACACATAAGCATACATATTTGTTTC
GTTATCTGTTAATTATGTTGTGAACACCAGTATATATCTCTAACACATTTCTGTAACTGTAAACACGAGCTCTATTGAATGACCTATCCT
AGTGGAATCCCCGATGTGTCACTGGATCCAATAGATTTGCTTCATTAATTTGGAGCTTGTGCATCCTATAGATGTTTGGTGATGCAGTAG
ATATAGGTAGGGCAAAAAGGTAGAATCATTCCCTTGTTAACAACATCAAGGTATTAGTCCCTTGCATTTCTTTTAGCTATATAAAGTTCT
GAACTTTACGCAGGAACCAATGATTCTCAGAATCTTAATCAGTAGTTTCAGGGAATATTTTAATCATTCTGGTGCCTATGTAAGAGTGTT
CGCTTG
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 53349)
Chromosome
5
Position
43.02 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_5 MQTL_1_Maturity_5 MQTL_2_Late_blight_5
Potato meta-QTL consensus map

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8807)
Chromosome
5
Position
90.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG524 was used as an overgo probe on plate 5 [well D8]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P008N02,   P052C07,   P291F14,   P026M21,   P046A06,   P023C20,   P244P19,   P291N17,   P254I24,   P116D09,   P253K13,   P263F23,   P284P18,   P093P14,   P098B16,   P003C18,   P218D18,   P027E04,   P027H09,   P169M15,   P133P05,   P263L12,   P167A22,   P253K12

 Overgo Sequences

A sequence
CTTGGCTGGACGTATTGATGTCAG
B sequence
GTTTAGTTGGTTGTTGCTGACATC
AB sequence
CTTGGCTGGACGTATTGATGTCAGCAACAA
Marker sequence
GCCATAGCAGCGAAGTCATTAATAATTGGAGAGACGGTATATATCGAATA
TCAACTTGGCTGGACGTATTGATGTCAGCAACAACCAACTAAACAAAATA
TTTCCATTTGCTTCAACAAATATGGCAAGAAAGAGTGACAGATCATCTCG
AAATTGTTTGGCTTGATGTAGGAAAATAGAAGAAAAAAAAAGAAAAGAAC
AGATCTTCAAATGGAAGATGGGAGAAACTTTCCTTCTTTCCCTTCTTTTT
CCTTTTCAAAGCAAGGATTATTTCCGCATAAAAGATGTTTCCATGGACTT
AGTATATTCATATTACCAGGTGGTTGAGGGCGGGAAGCTGTGAAGTCGAG
AGCTAGAAGTATACATTATTAATTTATAGATGTCTGGTTCATTTCAAACA
ATTACACAATCAATTTTTACTAAAGTTCCATTTCCCAAGTGTTTTTACAC
ATCCGTTGTCTCATTCATAGAAAATATCTATCAACTGAATGAATACA
Genomic location of TG524  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D284 marker 284
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)