Notice: The website will be down for maintenance on Aug 18th (Sunday).

SGN Marker TG452

SGN-M285

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1200
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG452 image not available
Forward sequence
GGGAGACAGCTTGCATGCCTGCAGATTAGGTATAAAAACGCATATAATACTTTTTTAGACTCCTGTACACCTTCTTCTCTGATTTAAACG
TGTATTCAAACACTTGTTTCGTATATCAATGTATATTTATGTATACAACCTGTATACCTTCCATATTGGAGAGTTGTGTTTCAATTTTCA
GCCCGCATTTTGCTTTTATTTGCCCTATATTTAGCTTTCTGACAGCTTGGACTATGAGTACGAACGACTCGATAAAAGAGGAGTGTTTAG
TTTCAATCCAATTTGAGAAGCAGGGAGGGAGTCTCAATAGACTCAAACGAGGGTTTCATGCAAGGAAGACAAAAGAAAGAACAAAACTAG
CGCTTTGATACAAGAATATAAAGGCGTCTTGACTTAGTTGAAAAAGAGTAACTTAAGTTGTTTAAACCAAAATGTAACTAAAAGTATTCA
TTAAACTTCAAAAAAGTTAGATGGCTTTTGAGAAGAATAAAAGAAAAACGAACTAACTATGCATCAAAAACCAACACATCTAAAACT
Reverse sequence
AATATCGATTTTTTAGATTATGAGGTGAGGGTTAGTCGTTTTTTCTAAAACCTTTGATTCTCACTGTTCGGTTCGGAGCCTAAAGTATCA
TTTAAATTTTAATTTCTAATCAGTATGTCGTTCATATATTAGTGCCCATAAATGCATAATCATCAGTCATGCCTTCGTTTGCTTACCACT
ATGTTTTTAGCTTGCTCTGCTATTAGTTTTATGGGGTCATATAAACTTGTTATACATATCGCATATACTTATGGCCTCTCTGTTTGGTTT
TCGTGTTTATACATATCGCATATACTTATGGCCTCTCTGTTTCATTTTCGTGTTTATGCCTGAAATATTTGGATTAGCATTATGGTATAG
ATCGAAAGGCTGTGTTAAAGTTTGATCAAAGGGAGTAGTTTTATACTAAGTTCGATGGACGTTCACTGTTGCATTGTTGCATTATTATT
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato-EXPEN 1992   
Map version
28 (location: 8808)
Chromosome
7
Position
21.70 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG452 was used as an overgo probe on plate 9 [well H1]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P031H12,   P123E04,   P272N22,   P021F17,   P285M08,   P256I09,   P122P06,   P070F15,   P293C12,   P326F03,   P031N02,   P305I05,   P060B16,   P107O14

 Overgo Sequences

A sequence
AGCTTTCTGACAGCTTGGACTATG
B sequence
TCGAGTCGTTCGTACTCATAGTCC
AB sequence
AGCTTTCTGACAGCTTGGACTATGAGTACG
Marker sequence
GGGAGACAGCTTGCATGCCTGCAGATTAGGTATAAAAACGCATATAATAC
TTTTTTAGACTCCTGTACACCTTCTTCTCTGATTTAAACGTGTATTCAAA
CACTTGTTTCGTATATCAATGTATATTTATGTATACAACCTGTATACCTT
CCATATTGGAGAGTTGTGTTTCAATTTTCAGCCCGCATTTTGCTTTTATT
TGCCCTATATTTAGCTTTCTGACAGCTTGGACTATGAGTACGAACGACTC
GATAAAAGAGGAGTGTTTAGTTTCAATCCAATTTGAGAAGCAGGGAGGGA
GTCTCAATAGACTCAAACGAGGGTTTCATGCAAGGAAGACAAAAGAAAGA
ACAAAACTAGCGCTTTGATACAAGAATATAAAGGCGTCTTGACTTAGTTG
AAAAAGAGTAACTTAAGTTGTTTAAACCAAAATGTAACTAAAAGTATTCA
TTAAACTTCAAAAAAGTTAGATGGCTTTTGAGAAGAATAAAAGAAAAACG
AACTAACTATGCATCAAAAACCAACACATCTAAAACT
Genomic location of TG452  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D285 marker 285
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)