SGN Marker TG526

SGN-M286

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1700
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
AAGCGCAAGGAGATTGTTCATTGCGTTACCCTTCACGAAATCGATGTCATAAATAGCAGGTATTAATTTGCTGCTAATGTTATGTGTTTA
TGGAAAGAAATGATTTTTTTGATTCCTTGTAGCTCGATTATCATATTGTTTTGTTGCAGCTTCTGTTTGTTGTTTTGTTATTATCTGTTG
ATACTTGTTCTCCCCTTACTTCTTTTTCTGGACTGCTTTGGACTGTTTTTCCTTGAGCTGACAGGACTACACTTGTTGTGTTGTTGGAAA
GGAATGATTTTGATTTATCTATGATTGCTTACTTAATTGTTCCTTTCTGCATTACCCTAGGTAATTGTTCTTTAATAGGAATAAGAGTAA
GTGTCAACGGCTACTCTGTGCTGTTTTGTTATTATCGGTTGATTCTTGTAATTCTGTTGCTTTTATTTCTGAACTGCTTTGGAGTGCTTT
TCCTTGAGGCGATTGTCTATGGAAACAACCTCCTTACCTTTGAGGTAG
Reverse sequence
GGAGACAAGCTTGCATGCCTGCAGAAGTGATAAGATGGATGGCGTATCTCAAAGAAGTATTAACCCCGATCTTGGTCAATAAAACTTTTG
CATCCTCAGACATTTCTACATCCTCCTCTTGGCATCTGATGTCCAGGATTTTGCGAATTTCTTCCTCTTTGTAAGGTTGTGTAGAGATGA
TGAGCAGGCGATCAAGAAAGTCAATTGGAATCCCGTGTGGGGATCTGTAGTTTGTTCCCCGGATTGTAGTAATGCCTCTATTTGTAGCAA
CAACCAATATAGGTGCCATGTCATTCTCCAGAGCTCGGTTTAGGAAAGAGAAACACTCAATGTCAAGCATATGTACTTCGTCAATGAAGA
GGACACCGGGCACAATCTCTGCCTTCCCTTCCTCCCTCCACTCAGCAACCTTGGTATCTATTTGTTCTCTCACTTCAGCACGAATCTCAC
CAGTATCACCCGTAAATAGTGCTAAAAATCCCTGTGTTCTGAAATTGAGATGAGCTGATTAACATATTTAATCTAGTGAAGTAGGAAACA
AGG
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1641631e-137302 (55.6% of RFLP seq)-
Mapped locations  
Map: Tomato QTL map   
Map version
137 (location: 53901)
Chromosome
3
Position
38.70 cM
Confidence
uncalculated
Protocol
RFLP

Titratable_acidity_ta3_1 Fruit_diameter_fd3_1 Elasticity_ela3_1 Fruit_weight_fw3_1 2_Phenylethanal_content_pea3_1 Carotene_content_car3_1 Sugar_content_suc3_1
Tomato QTL map

Map: Potato meta-QTL consensus map   
Map version
107 (location: 53350)
Chromosome
3
Position
6.30 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_3 MQTL_2_Late_blight_3 MQTL_3_Late_blight_3
Potato meta-QTL consensus map

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8809)
Chromosome
3
Position
47.50 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG526 was used as an overgo probe on plate 3 [well C10]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P174K10,   P060L11,   P280K10,   P316F11,   P288I18,   P190J03,   P039I12,   P181H03,   P120K04,   P032K04,   P288D21,   P066I10,   P105P07,   P070P03,   P298P15,   P016A20,   P111P20,   P176N14,   P073F23,   P176P02,   P151D16,   P217G24,   P102F18,   P062N06,   P035H10,   P066C10,   P075D23,   P309M23,   P162E12,   P100L22,   P336E06,   P024G18,   P111L01,   P217B17,   P252C11,   P315C24,   P213J10,   P203L23,   P118F01,   P107O13,   P172E16,   P030G20,   P104A16,   P103D18,   P203E19,   P218F09,   P334K18,   P231D07,   P252N07,   P176B05,   P099P06,   P051O04,   P084C19,   P286L06,   P317F17,   P203K13,   P246N16,   P236A04,   P024G19,   P113G22,   P031M05,   P299K17,   P260D03,   P010F15,   P079P08,   P235G07,   P240D09,   P250F23,   P251N22,   P217A24,   P324C07,   P273G22,   P116D01,   P103A03,   P102G11,   P302D18,   P224C01,   P160G23,   P162H17,   P109F16,   P212O06,   P156P18,   P288I17,   P060P18,   P288H18,   P092G24,   P241K10,   P074N01,   P234I17,   P288J18,   P185C01,   P281L02,   P217N10,   P163N19,   P120A07,   P173M07,   P284P01,   P149H19,   P118F10,   P020N01,   P174D19,   P044D05,   P204J08,   P238D24,   P151H12,   P160L07,   P177B17,   P058J20,   P331B12,   P313H05,   P084A16,   P208F09,   P110K24

 Overgo Sequences

A sequence
TGGACTGCTTTGGACTGTTTTTCC
B sequence
AGTCCTGTCAGCTCAAGGAAAAAC
AB sequence
TGGACTGCTTTGGACTGTTTTTCCTTGAGC
Marker sequence
AAGCGCAAGGAGATTGTTCATTGCGTTACCCTTCACGAAATCGATGTCAT
AAATAGCAGGTATTAATTTGCTGCTAATGTTATGTGTTTATGGAAAGAAA
TGATTTTTTTGATTCCTTGTAGCTCGATTATCATATTGTTTTGTTGCAGC
TTCTGTTTGTTGTTTTGTTATTATCTGTTGATACTTGTTCTCCCCTTACT
TCTTTTTCTGGACTGCTTTGGACTGTTTTTCCTTGAGCTGACAGGACTAC
ACTTGTTGTGTTGTTGGAAAGGAATGATTTTGATTTATCTATGATTGCTT
ACTTAATTGTTCCTTTCTGCATTACCCTAGGTAATTGTTCTTTAATAGGA
ATAAGAGTAAGTGTCAACGGCTACTCTGTGCTGTTTTGTTATTATCGGTT
GATTCTTGTAATTCTGTTGCTTTTATTTCTGAACTGCTTTGGAGTGCTTT
TCCTTGAGGCGATTGTCTATGGAAACAACCTCCTTACCTTTGAGGTAG
Genomic location of TG526  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D286 marker 286
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)