SGN Marker TG453

SGN-M287

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1600
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG453 image not available
Forward sequence
ATGGGCTATGCTTGGTGCTCTTGGATGTGTCTTCCCTGAGCTATTGGCCCGTAACGGTGTCAAGTTCGGTGAGGCTGTGTGGTTCAAGGC
CGGATCCCAGATCTTCAGCGAGGGAGGACTTGACTACTTGGGCAACCCAAGCTTGGTCCATGCACAGAGCATCTTGGCCATCTGGGCTTG
CCAAGTTGTCTTGATGGGAGCCGTTGAAGGTTACCGTATTGCTGGTGGACCTCTTGGTGAGGTTGTCGACCCACTCTACCCCGGTGGCAG
CTTCGACCCATTAGGCCTTGCTGAAGACCCCGAGGCATTTGCTGAGCTCAAGGTAAAGGAGATTAAGAACGGCAGACTTGCTATGTTCTC
TATGTTCGGATTCTTTGTTCAGGCCATTGTTACCGGAAAGGGTCCATTGGAGAACCTTGCTGACCACCTTGCAGACCCCGTTAACAACAA
CGCTTGGGCTTTCGCCACAAACTTTGTCCCCGGAAAATGAATATCATAAT
Reverse sequence
GTAAAATATACCACCACTATACTATCATTCAATGTAGAGTTATGGTTTAGGAAATTTGAGGAGTAGTTGAAACTAATTACTACTTGATTC
ATATATTTTGGGAACTTAATAATGCATCTTTATGTTCAGAAAGCAATGTGATTGAAACTTTATTATATTAAACCCTAATTAGCAAAGTTG
TTTATGTTAGCCAAACAGGTTATATTGCATTATGCTCATTCACAATACTACATGAGCAATGCTGAGACTTGGAAAGAGCTTGTTCCGAAG
AATATGAGCAAAGATTTTAATTTGTTGGAATTCATCAGCATCACAATTTTGGCTGTGTTAAGGGAAAAAGAAATTACATTAGTAAACTTT
AACATGTGATAGTAGGTCAATTCACATTTTTTACCAGACTACAGATTAATGTTATCAAGTGATTTGCCTTTAATTACTTACTTAGAAATT
TGATTGTGTAAATATTGTTTATGTTATTAGTGCGTAGAACTTGAATTTGTTGTCAAAAAGTGTCATATTT
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1556013.5e-0536 (7.2% of RFLP seq)+
SGN-U1437851.4e-0732 (6.4% of RFLP seq)+
SGN-U1607691.4e-0732 (6.4% of RFLP seq)+
SGN-U1638001.4e-0736 (7.2% of RFLP seq)+
SGN-U1434681.4e-0780 (16.0% of RFLP seq)+
SGN-U1605591.4e-0780 (16.0% of RFLP seq)+
SGN-U1437403.7e-0833 (6.6% of RFLP seq)+
SGN-U1437413.7e-0833 (6.6% of RFLP seq)+
SGN-U1607373.7e-0833 (6.6% of RFLP seq)+
SGN-U1434672.3e-0983 (16.6% of RFLP seq)+
SGN-U1605595.9e-1080 (16.0% of RFLP seq)+
SGN-U1434675.9e-1080 (16.0% of RFLP seq)+
SGN-U1433361.5e-10137 (27.4% of RFLP seq)+
SGN-U1433341.5e-10137 (27.4% of RFLP seq)+
SGN-U1605601.6e-1691 (18.2% of RFLP seq)+
SGN-U1434686.6e-1991 (18.2% of RFLP seq)+
SGN-U1604714.4e-23130 (26.0% of RFLP seq)+
SGN-U1637501.2e-26132 (26.4% of RFLP seq)+
SGN-U1433341.2e-29217 (43.4% of RFLP seq)+
SGN-U1637491.9e-3168 (13.6% of RFLP seq)+
SGN-U1637471.9e-31103 (20.6% of RFLP seq)+
SGN-U1556011.2e-32106 (21.2% of RFLP seq)+
SGN-U1637638e-3496 (19.2% of RFLP seq)+
SGN-U1556011.3e-35183 (36.6% of RFLP seq)+
SGN-U1433353.3e-36208 (41.6% of RFLP seq)+
SGN-U1638035.3e-3887 (17.4% of RFLP seq)+
SGN-U1433331.3e-38220 (44.0% of RFLP seq)+
SGN-U1555213.5e-42178 (35.6% of RFLP seq)+
SGN-U1637616.7e-56133 (26.6% of RFLP seq)+
SGN-U1638071.1e-60125 (25.0% of RFLP seq)+
SGN-U1637604.6e-63233 (46.6% of RFLP seq)+
SGN-U1637477.4e-65224 (44.8% of RFLP seq)+
SGN-U1637615e-69146 (29.2% of RFLP seq)+
SGN-U1638056e-84192 (38.4% of RFLP seq)+
SGN-U1638037.2e-99221 (44.2% of RFLP seq)+
SGN-U1637463e-101229 (45.8% of RFLP seq)+
SGN-U1638041e-112276 (55.2% of RFLP seq)+
SGN-U1637556e-118241 (48.2% of RFLP seq)+
SGN-U1638016e-121390 (78.0% of RFLP seq)+
SGN-U1637512e-148448 (89.6% of RFLP seq)+
SGN-U1555979e-157486 (97.2% of RFLP seq)+
SGN-U1556022e-157491 (98.2% of RFLP seq)+
SGN-U1637534e-168361 (72.2% of RFLP seq)+
SGN-U1555223e-169491 (98.2% of RFLP seq)+
SGN-U1637494e-171302 (60.4% of RFLP seq)+
SGN-U155519488 (97.6% of RFLP seq)+
SGN-U155600492 (98.4% of RFLP seq)+
SGN-U155529491 (98.2% of RFLP seq)+
SGN-U155604461 (92.2% of RFLP seq)+
SGN-U155599493 (98.6% of RFLP seq)+
SGN-U155518500 (100.0% of RFLP seq)+
SGN-U155520499 (99.8% of RFLP seq)+
SGN-U155603499 (99.8% of RFLP seq)+
SGN-U163802432 (86.4% of RFLP seq)+
SGN-U1525075.9e-0768 (13.1% of RFLP seq)-
Mapped locations  
Map: Tomato-EXPIMP 2009   
Map version
126 (location: 53555)
Chromosome
3
Position
0.04 cM
Confidence
uncalculated
Protocol
RFLP
Subscript
A


Tomato-EXPIMP 2009

Map: Tomato-EXPIMP 2009   
Map version
126 (location: 53556)
Chromosome
2
Position
37.56 cM
Confidence
uncalculated
Protocol
RFLP
Subscript
B


Tomato-EXPIMP 2009

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8810)
Chromosome
2
Position
41.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG453 was used as an overgo probe on plate 15 [well H9]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P322K16,   P248B01,   P279J05,   P242B02,   P271P14,   P174G08,   P029A19,   P289P08,   P112B07,   P027B18,   P279L03,   P162A10,   P186O09,   P075N03,   P091J18,   P240C13,   P069A04

 Overgo Sequences

A sequence
ATGCTTGGTGCTCTTGGATGTGTC
B sequence
CCAATAGCTCAGGGAAGACACATC
AB sequence
ATGCTTGGTGCTCTTGGATGTGTCTTCCCT
Marker sequence
ATGGGCTATGCTTGGTGCTCTTGGATGTGTCTTCCCTGAGCTATTGGCCC
GTAACGGTGTCAAGTTCGGTGAGGCTGTGTGGTTCAAGGCCGGATCCCAG
ATCTTCAGCGAGGGAGGACTTGACTACTTGGGCAACCCAAGCTTGGTCCA
TGCACAGAGCATCTTGGCCATCTGGGCTTGCCAAGTTGTCTTGATGGGAG
CCGTTGAAGGTTACCGTATTGCTGGTGGACCTCTTGGTGAGGTTGTCGAC
CCACTCTACCCCGGTGGCAGCTTCGACCCATTAGGCCTTGCTGAAGACCC
CGAGGCATTTGCTGAGCTCAAGGTAAAGGAGATTAAGAACGGCAGACTTG
CTATGTTCTCTATGTTCGGATTCTTTGTTCAGGCCATTGTTACCGGAAAG
GGTCCATTGGAGAACCTTGCTGACCACCTTGCAGACCCCGTTAACAACAA
CGCTTGGGCTTTCGCCACAAACTTTGTCCCCGGAAAATGAATATCATAAT
Genomic location of TG453  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D287 marker 287
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)