SGN Marker TG527

SGN-M288

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1400
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG527 image not available
Forward sequence
TCTTTTGGTAATGCACCAGTAGAAGGAGATTCGCATGAATGCCTTGAAATTGATCCTAACCACTCCGATATCGCCTGCTCGGATGATTCT
GACAAGTCAGATAATGGAAATGACAAATGCGCAAGTGCATTCCTTTCTGAAAAAAAGAGGGAAGAAAATTTTGTCAACGCCTCTCTTTCA
CACTATGGGACCTTAAACAACTACTTCATTGACTTCAATAGCGTAGATCTGGAAGAAAATGCTCCTGACAGGACTCATCTGGGACAAACT
AGGGATGGAGAACATAATTTAACAAGCACCTCCACCAAAGAGGTCACAAATGCCTGCTCAAATAAGGTAGCAGGGCAGAAATCTCTAGCA
GGTTTATGTATACTGCTTGCTGAGGATACCCCAGTTCTGCAAAGAGTCGCTACCATAATGCTGGAAAAATTGGGAGCTAAAGTGGTGGTT
GTAGGAGATGGACTACAGGCAGTGGAAGCACTGAAACCCGTGCCTAATTCAGATG
Reverse sequence
GGAGACAGCTTGCATGCCTGCAGCCATGTCTTCCACAGGGGATGCCTTGATACTTGGGTGAACGATGGACACGTCACTTGCCCCTTGTGC
AGATCTATGTTGCTACCCCCTAAGTTGACCTCTTTCCGATCTAATTCTCTAAATCCATCCATTAGTTAGTTTTCGATGCTTATTACAAAC
TTCTGCTTTAACTATAACAGATGCAAAATTAGTGTTTACAGACATTTCCTGTACAGATTTCCATACTTTTTCTAATAAAAAATCTGATAA
ACTTATTGAGACTTTTGCATAAGCTGTAGAACAGTTACAAAGTTAGTTTCCTGTACAGATTGCAATACTATTGCTTATCAAAGCTCTGCT
TTAAGCTCATGAGTTTTCTGAGCTCTTCCATTTTTGTTTGTTTCTTCCGTTTTTGATAGAGAGGTATGATGGTTAGGCTTTTCTTTTAGT
CAAGGAAAGAATGGTGGAAACCATCAACTTGCTGTCTATGGGCTTGGTTAAATAAGCATCCATACCAACCTGTAAGCATTTTGCTTCATC
TGATG
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U159884363 (66.6% of RFLP seq)-
Mapped locations  
Map: Tomato-EXPEN 1992   
Map version
28 (location: 8811)
Chromosome
2
Position
68.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG527 was used as an overgo probe on plate 16 [well D10]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P323K11,   P308O01,   P173M22,   P280A16,   P023J09,   P061F07,   P142H13

 Overgo Sequences

A sequence
TGATCCTAACCACTCCGATATCGC
B sequence
AGAATCATCCGAGCAGGCGATATC
AB sequence
TGATCCTAACCACTCCGATATCGCCTGCTC
Marker sequence
TCTTTTGGTAATGCACCAGTAGAAGGAGATTCGCATGAATGCCTTGAAAT
TGATCCTAACCACTCCGATATCGCCTGCTCGGATGATTCTGACAAGTCAG
ATAATGGAAATGACAAATGCGCAAGTGCATTCCTTTCTGAAAAAAAGAGG
GAAGAAAATTTTGTCAACGCCTCTCTTTCACACTATGGGACCTTAAACAA
CTACTTCATTGACTTCAATAGCGTAGATCTGGAAGAAAATGCTCCTGACA
GGACTCATCTGGGACAAACTAGGGATGGAGAACATAATTTAACAAGCACC
TCCACCAAAGAGGTCACAAATGCCTGCTCAAATAAGGTAGCAGGGCAGAA
ATCTCTAGCAGGTTTATGTATACTGCTTGCTGAGGATACCCCAGTTCTGC
AAAGAGTCGCTACCATAATGCTGGAAAAATTGGGAGCTAAAGTGGTGGTT
GTAGGAGATGGACTACAGGCAGTGGAAGCACTGAAACCCGTGCCTAATTC
AGATG
Genomic location of TG527  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D288 marker 288
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)