SGN Marker TG528

SGN-M289

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1600
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG528 image not available
Forward sequence
AGTGAGGCTTATACCTATTTTTCTTCTTATGTGGTAGTGGAAATTGCAACTATTTATGTATATATCTTGAGATGAAGATAGTAGGTGCAC
CCATTCCCTTGACTGTTTCAGTTTTTTCGCTTTGTCCACCTAATGAGATTTTCCCAGACTAAACATGTCTGTGATTTTATTGCTACTGGA
GTGCTAATTAATCCATGTTAAGAGAATGGTTTTTCGAACTTGGGTTGATTCCTTGATGAGCTTTATATTCAAAGTTTATTCATATGTTGA
TAGAATTTGCTCTTAGATGTGTATACCAATTCGTAGTTGATTCTTGAGTCAACTTGAGGCTGAGCTTCTTCACAATGAACTAATCACAAG
CAAGATTTTTTTATATAAATTAATTAGAACATTGTTTGCTAGTTTTCTGTATACTACTTGCATACAGGTGTTTTATGCCCTCCATTAACA
CAATCTACTTCATCTTTTTTGATAACACAAATGTACTTAC
Reverse sequence
GGAGACAAGCTTGCATGCCTGCAGAGCCTCTTCACGCCCTTTAGCAGCAGCTAGTTCTTGCTCTGCATTGAGAAATTGATCACGAAATTT
CTTCCTTTCAGCATCTGCACGTGTAATTCATGTCATCATGCAAATTAATCAATAAGTATTGGAGTATACTTTGCAGAAAAGGTGAATTAC
AAACCAAATAGTCATTATCCCTCCAGTGGAGTAAAGGGTCAGTGGTGAACAGAGAGAAAAAAATACAAAGGAAATTAACAAAAGAAAAAT
AAAAGGCATGACAGTTGCTACAAAGGAGTCAACACATGATTAAGGAGACAAAAGATATGAAGACAAATAATATCACTCCAATATGTGTAT
GAATGGATGTATGTTTGTGTGTATCTATATATGTATGCCTGTATCCATTTATGTAAACACGTGTGTGTATGTTGGAAAGTTACTTCAGTG
AAGTTGCCAGTTCTCACATATAAATTTTGAAATAAAGAAGACAGCCTTTTAACAATTGAAATCAGGGGAGCAATTGAACTGTACAAACAA
GATTAGC
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1553542.5e-4388 (16.1% of RFLP seq)-
Mapped locations  
Map: Eggplant-COSII   
Map version
63 (location: 42484)
Chromosome
1
Position
119.00 cM
Confidence
I
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40077)
Chromosome
1
Position
127.50 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Eggplant-LXM 2002   
Map version
29 (location: 8813)
Chromosome
1
Position
132.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8812)
Chromosome
1
Position
93.60 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG528 was used as an overgo probe on plate 14 [well G6]

Plausible BAC Matches:   P165P08,   P011B13,   P109H18

 Non-Plausible BAC matches

P214P13,   P226A22,   P261D11,   P164M23,   P005K16,   P332J16,   P048B10

 Overgo Sequences

A sequence
TGAAGATAGTAGGTGCACCCATTC
B sequence
ACTGAAACAGTCAAGGGAATGGGT
AB sequence
TGAAGATAGTAGGTGCACCCATTCCCTTGA
Marker sequence
AGTGAGGCTTATACCTATTTTTCTTCTTATGTGGTAGTGGAAATTGCAAC
TATTTATGTATATATCTTGAGATGAAGATAGTAGGTGCACCCATTCCCTT
GACTGTTTCAGTTTTTTCGCTTTGTCCACCTAATGAGATTTTCCCAGACT
AAACATGTCTGTGATTTTATTGCTACTGGAGTGCTAATTAATCCATGTTA
AGAGAATGGTTTTTCGAACTTGGGTTGATTCCTTGATGAGCTTTATATTC
AAAGTTTATTCATATGTTGATAGAATTTGCTCTTAGATGTGTATACCAAT
TCGTAGTTGATTCTTGAGTCAACTTGAGGCTGAGCTTCTTCACAATGAAC
TAATCACAAGCAAGATTTTTTTATATAAATTAATTAGAACATTGTTTGCT
AGTTTTCTGTATACTACTTGCATACAGGTGTTTTATGCCCTCCATTAACA
CAATCTACTTCATCTTTTTTGATAACACAAATGTACTTAC
Genomic location of TG528  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D289 marker 289
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)