SGN Marker TG307

SGN-M29

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
800
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
GACACTATACCAAAGAAGAAAAGAAGTCATTCATAATCTACAATAAATTTAAACAAAATTAATAAAATATGAAAGACGGCTTTAGGAATT
AAATACATCAGCAATTTTTTTCAGCAAAAAGCATCACAAACCCACAAAATCAAAGCAAATAGAACATGTAATTCTGGAATAATGGTGCAT
TTGTGCATTGGGGGTGAGAGAGTAAAATGAAGAAGCAAATTCATGAGTGATTTAGAATCTACATTTTAGGAAGTAATGGTGATATTTCCT
AGTCACCTTTAGTTGATATAGTAAACCCACCCACCCACCCACCCAAAACTATTGCACTCAGGAGCCAAACAGTGTCTCGATCTCATTTTT
GCTCCCTTGGTAATTCTAACCCCCATCCTTGGTTAGAGGTGAAGAGTCTTTACCACTAGGCTATCCCTCATAATGTAATTCAGGAAAACT
TTTTATGTTTGTTTAACTCAATAAAAATTCTAGTCTCCTGATCCCAATATATATATGCACTGGTATTTGATTTTTTTTACTCCTACTGCA
CATATGA
Reverse sequence
ACAACTTGACTAGAGCTAAAGATTGTTTCATTTTTCTGATTTTCTTTTCCTTTTGTGTAATATGAAATTTATCATTTGATTCTGCGTTTG
GAGATAAAAAAACACATTCCATGGCACAAGGTCCAGGGAATATTTGTAACCTGACAGAATATTGTCAACTAGTGATGCCGGTCATCATGA
TGAATGATTCAGTTTGATGGACACTCCATGTTAAACTTGTTGAAGTAATCCCTGTTTCAAATATCGGCCCTCATTTTAATTCTATTTGGA
AGCTACTTGCACATTCATATGTGCAGTAGGAGTAAAAAAAATCAAATACCAGTGCATATATATATTGGGATCAGGAGACTAGAATTTTTA
TTGAGTTAAACAAACATAAAAAGTTTTCCTGAATTACATTATGAGGGATAGCCTAGTGGTAAAGACTCTTCACCTCTAACCAAGGATGGG
GGTTAGAATTACCAAGGGAGCAAAAATGAGATCGAGACACTGTTTGGCTCCTGAGTGCAATAGTTTTGGGTGGGTGGGTGGGTGGGTTTA
CTATATCAACTAAAGGTGACTAGGAAATATCACCATTACTTCCTAAAATGTAGATTCTAAATCACTCATGAATTTGCTTCTTCATTTT
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato-EXPEN 1992   
Map version
28 (location: 7802)
Chromosome
8
Position
35.70 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG307 was used as an overgo probe on plate 12 [well F2]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P022H14,   P117C11,   P257A01,   P037O11,   P202G09,   P184L22,   P244J03,   P170C07,   P076L05,   P267L18,   P257A02,   P266L18,   P276D11,   P177B24,   P210B22

 Overgo Sequences

A sequence
CACCCACCCAAAACTATTGCACTC
B sequence
ACACTGTTTGGCTCCTGAGTGCAA
AB sequence
CACCCACCCAAAACTATTGCACTCAGGAGC
Marker sequence
GACACTATACCAAAGAAGAAAAGAAGTCATTCATAATCTACAATAAATTT
AAACAAAATTAATAAAATATGAAAGACGGCTTTAGGAATTAAATACATCA
GCAATTTTTTTCAGCAAAAAGCATCACAAACCCACAAAATCAAAGCAAAT
AGAACATGTAATTCTGGAATAATGGTGCATTTGTGCATTGGGGGTGAGAG
AGTAAAATGAAGAAGCAAATTCATGAGTGATTTAGAATCTACATTTTAGG
AAGTAATGGTGATATTTCCTAGTCACCTTTAGTTGATATAGTAAACCCAC
CCACCCACCCACCCAAAACTATTGCACTCAGGAGCCAAACAGTGTCTCGA
TCTCATTTTTGCTCCCTTGGTAATTCTAACCCCCATCCTTGGTTAGAGGT
GAAGAGTCTTTACCACTAGGCTATCCCTCATAATGTAATTCAGGAAAACT
TTTTATGTTTGTTTAACTCAATAAAAATTCTAGTCTCCTGATCCCAATAT
ATATATGCACTGGTATTTGATTTTTTTTACTCCTACTGCACATATGA
Genomic location of TG307  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D29 marker 29
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)