SGN Marker TG457

SGN-M290

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
800
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG457 image not available
Forward sequence
AAAGTAAATATTATGAGTTGTAAAGATGAATTATAATGCAAGTAGACGACCACAAAGGCCAGGTGACTTTATTAGGTCTGAGCCTTTGAG
GTTGACTTATAAAGGAACTTTTAGTGTTTTTCTTCATTACTTCTTATAAATAATTAATCGATCTGAACTGTAATGCATTGGTGAAATTTT
GCTAGACTGTTAATTAGAGGTCTCGAGTTTAAGTCAGAAAATTTTATTGGAAGTGTTACTCTCGAATGAACCTTGTAATACATGATTCAA
ATTTAATCGAGACTTTAATATGAGTTATAAATATTCGAAAAACAAGATTAAAAAAACAGCTTAATTATTATTCTGACAAAATATCTTATA
AAGGGAAAAGACAATACCAAGTGTGGGTGATGAAGAGATTTGGATTAAAGCTGTTTTGGATCATCAATGCCATATGCTTTGGATCAATAA
CCATCTACTAATATATATTTTTAAAAGCTGTGATGTATGGC
Reverse sequence
GGAGACAGCTTGCATGCCTGCAGTTAATAGTTGGCTCTTTTCTGAGAGCATGAATACATATTTCTTTTTCTTCTTTTAAATATATATTGA
TCATGTTTGTGTTTATTTCTTCCTTCTCTTAGATACTGTCAAATGAGTTTGTGTGTTGGTTTCCCCTCTCATTATATGAATTCTGAAATA
AATGATATACTGTAAATCTTTCCCATTTTGTCTAGCATCTGGCAAGCCTGTTTAGAAATACTGTAAAGCTAGTTGTCATTTGCATGCCAT
ACATCACAGCTTTTAAAAATATATATTAGTAGATGGTTATTGATCCAAAGCATATGGCATTGATGATCCAAAACAGCTTTAATCCAAATC
TCTTCATCACCCACACTTGGTATTGTCTTTTCCCTTTATAAGATATTTTGTCAGAATAATAATTAAGCTGTTTTTTTAATCTTGTTTTTC
GAATATTTATAACTCATATTAAAGTCTCGATTAAATTTGAATCATGTATTACAAGGTTCATTCGAGAGTAACACTTCCAATAAAATTTTC
TG
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Eggplant-COSII   
Map version
63 (location: 42465)
Chromosome
3
Position
102.60 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-COSII

Map: Eggplant-LXM 2002   
Map version
29 (location: 8816)
Chromosome
3
Position
113.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8815)
Chromosome
3
Position
70.70 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG457 was used as an overgo probe on plate 4 [well E4]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
GGCCAGGTGACTTTATTAGGTCTG
B sequence
GTCAACCTCAAAGGCTCAGACCTA
AB sequence
GGCCAGGTGACTTTATTAGGTCTGAGCCTT
Marker sequence
AAAGTAAATATTATGAGTTGTAAAGATGAATTATAATGCAAGTAGACGAC
CACAAAGGCCAGGTGACTTTATTAGGTCTGAGCCTTTGAGGTTGACTTAT
AAAGGAACTTTTAGTGTTTTTCTTCATTACTTCTTATAAATAATTAATCG
ATCTGAACTGTAATGCATTGGTGAAATTTTGCTAGACTGTTAATTAGAGG
TCTCGAGTTTAAGTCAGAAAATTTTATTGGAAGTGTTACTCTCGAATGAA
CCTTGTAATACATGATTCAAATTTAATCGAGACTTTAATATGAGTTATAA
ATATTCGAAAAACAAGATTAAAAAAACAGCTTAATTATTATTCTGACAAA
ATATCTTATAAAGGGAAAAGACAATACCAAGTGTGGGTGATGAAGAGATT
TGGATTAAAGCTGTTTTGGATCATCAATGCCATATGCTTTGGATCAATAA
CCATCTACTAATATATATTTTTAAAAGCTGTGATGTATGGC
Genomic location of TG457  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D290 marker 290
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)