SGN Marker TG386

SGN-M291

SynonymsNone
Locus associations  
This marker is associated with the late blight resistance locus.

RFLP details 
Insert size
700
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG386 image not available
Forward sequence
TTGCATGCCTGCAGTGCCAATGAGTTCTAGTCACTGGAAGAGATGGGAGTTCAGCTCCACAACCTTCATGTCAAACACAATGCAATAATT
TCCATTTTAGCAACACATTAAACATGCTATTGATGTATAATTTAGTACACTAAGCATGGCAGGAGAAATGGAAGCAACACATGTTAAACA
AGAATCACTAGTTTTTCCCGCTACCACTAGCACTGAGTCATCATATTCACGGCTTCTTAAATGAGGTTCATTCAGGCCAATGAAGTTTCG
CATATTTTATTAAGGCACTCTCATAATATAAGGCAGCCCCTTGAAGTAGTTAATGGGACACTTTAAGCTTCATTCAGAAGGGAACCAATT
TTG
Reverse sequence
TGAATGAATCAAGCGATAGTTCTATCTTTACAATTTGTGTATGTTATTTGATATGACATTGTTTTTTTGTTTGTATTAGATTGTGTAAGA
GCTGAACCTGTGATATACAAGAAACTGGAAGCATCATATGATGATATAGCACTTCTGAGGGCTTATGTCGGGGACAGACCTACTTGGAGG
ACTCCACAGCACCCATGGCGAGTAGATGGGAGGTTCAACCTCAAAGGGGTACCAACCTTAATCACATGGGAAAATGATGCAATCAAAGGT
CGTCTTGAAGACCATGAAGCACACCTTGATCACAAAATTGGTTCCCT
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1447688e-166293 (80.7% of RFLP seq)+
SGN-U1447683e-131239 (75.4% of RFLP seq)-
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 53292)
Chromosome
10
Position
48.33 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_10 MQTL_2_Late_blight_10
Potato meta-QTL consensus map

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 50381)
Chromosome
10
Position
18.29 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 48315)
Chromosome
10
Position
31.77 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Eggplant-COSII   
Map version
63 (location: 42451)
Chromosome
4
Position
60.20 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40022)
Chromosome
10
Position
34.00 cM
Confidence
CF(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Eggplant-LXM 2002   
Map version
29 (location: 8818)
Chromosome
4
Position
38.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8817)
Chromosome
10
Position
34.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 8822)
Chromosome
10
Position
7.10 cM
Confidence
I(LOD2)
Protocol
RFLP


Potato-TXB 1992
Overgo hybridization and physical mapping 
TG386 was used as an overgo probe on plate 1 [well D7]

Plausible BAC Matches:   P227A22,   P334K21,   P145F21,   P290L04,   P111D09,   P244E18,   P042G18,   P193K08,   P092C09,   P252O11,   P040F15,   P314E21,   P035L07,   P209J11,   P326H12,   P197E16,   P279E12,   P091F14,   P158L11

 Overgo Sequences

A sequence
GCAGTGCCAATGAGTTCTAGTCAC
B sequence
ACTCCCATCTCTTCCAGTGACTAG
AB sequence
GCAGTGCCAATGAGTTCTAGTCACTGGAAG
Marker sequence
TTGCATGCCTGCAGTGCCAATGAGTTCTAGTCACTGGAAGAGATGGGAGT
TCAGCTCCACAACCTTCATGTCAAACACAATGCAATAATTTCCATTTTAG
CAACACATTAAACATGCTATTGATGTATAATTTAGTACACTAAGCATGGC
AGGAGAAATGGAAGCAACACATGTTAAACAAGAATCACTAGTTTTTCCCG
CTACCACTAGCACTGAGTCATCATATTCACGGCTTCTTAAATGAGGTTCA
TTCAGGCCAATGAAGTTTCGCATATTTTATTAAGGCACTCTCATAATATA
AGGCAGCCCCTTGAAGTAGTTAATGGGACACTTTAAGCTTCATTCAGAAG
GGAACCAATTTTG
Genomic location of TG386  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D291 marker 291
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)