SGN Marker T1957

SGN-M2913
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39804)
Chromosome
1
Position
34.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1957 was used as an overgo probe on plate 11 [well E5]

Plausible BAC Matches:   P165J09,   P265G18,   P329P20,   P224F08,   P165I09,   P152O11,   P100C01,   P168I13,   P249E22,   P239N23,   P316E08,   P075J10,   P070O17,   P031H20,   P324J14,   P308F13,   P154P20,   P125F03,   P202G04,   P183B23,   P301L12,   P230M10,   P095K03,   P249D22,   P138L16,   P100D01,   P072O04,   P003G01,   P087G21,   P101A07,   P146K03,   P043F04

 Overgo Sequences

A sequence
CAATCAGGTCTTGCCAATTGGAGG
B sequence
CAATGCCTTCCAGGGTCCTCCAAT
AB sequence
CAATCAGGTCTTGCCAATTGGAGGACCCTG
Marker sequence
GAAAAGTGTACAAGGTTTAGGGGTTTCAATTGATGTTGTTGTGTCTTGTC
TTGCTAGTCGAAATGGTGGGGTAAAAGATTCTTGGAATATCGATTATGAG
GCAACAAAGAATAGTCTTGTTGCTGGGAGGAAGTTTGGGGCTTCACACTT
TGTTTTGCTGTCTGCAATTTGTGTTCAAAAGCCCCTTCTTGAATTTCAAA
GAGCTAAGCTGAAATTCGAGGCGGAATTGATGAAAGAAGCTGAAGAAGAT
AATGGATTTACTTATAGTATTGTTAGACCTACTGCATTTTTCAAGAGCTT
AGGAGGTCAGGTTGAATTGGTGAAAGATGGGAAACCTTATGTGATGTTTG
GGGATGGAAAGTTGTGTGCTTGCAAGCCGATAAGCGAACAAGATTTAGCT
TCTTTTATGGCTGATTGTGTACTGAAAGAGGATAAAATCAATCAGGTCTT
GCCAATTGGAGGACCCTGGAAGGCATTGACACCTTTAGAACAAGGGGAAA
TGTTGTTTAAACTTGTGGGG
Genomic location of T1957  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2913 marker 2913
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)