SGN Marker CD22

SGN-M292

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1000
Vector
pUC
Cutting Site
PST1
Drug Resistance
AMP
Image
CD22 image not available
Forward sequence
GGGGGGGGGGGGGNGAAAACCTTCATTATACTAAGGGGCATTACACATACAACATATTTTCGAGTGAGGATAAGTAATGCATTAAAAATA
TATTGACAAGTTTTCATCTATCATATTCGGCTTAATCTTACATCAGTGCAGAAATTCGCCAAGTTTGTAAGATTCTTTCATTTCCTTTAT
GGTCATCGAAGGTTAACTTTCACCTTACATTAGATCTTCCATTCCATTATAACTGGCTTTTACATATACAACATCCTTT
Reverse sequence
TGCAGGGGGGGGGTGTCCGGAAATAGGTTTGCTGGAGGAACATAGCCATGAGCATGAAGCTGTGACCCAACACTTGCCACAGACGGGATG
GAGCTTAGCTCCAAGAATTGAACCAGTTGTGCGTGCAATATCTGACTGCAAATTTCCATCTTTTCTAGATGATACATCTTGGTTACATAG
AGGTTCTGATGTGGATTTAAAAAGCCAGATATTACAACTTCAAAGTTGTCTAACAAAGTACTTCACAGAGATTAGCAAGTTGATGGTACT
GCCACTTGCAGAAAAAGAGGCAAGTGTTATGATGCAGAAGTTTGTGCAGCTTCAACTCCAGAACTCATACTACTACATTGTTCCAAACTG
GGTTATGATTTTCCAACGGGCATTCAATTGGCAGTTGATGAAATTAGCTAAGGAGACATCTTTCTCAGTGTATATCCTGATAAAGCATGA
TTTGTCCACTTCAATGCTTGGAGCTGTGGAACTCGAAGCCTCTGCACAGCCGCATTACCATTTGTCACATCCATCTCTTGATGAAATGGT
TGAAGCTGGGCGGATGCCTCTTCTCGGATGTGCTATGCTTGATGGGGA
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 51700)
Chromosome
12
Position
44.25 cM
Confidence
uncalculated
Protocol
unknown

MQTL_2_Late_blight_12 MQTL_1_Late_blight_12
Potato meta-QTL consensus map

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8824)
Chromosome
12
Position
42.60 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 8823)
Chromosome
12
Position
37.20 cM
Confidence
I(LOD2)
Protocol
RFLP


Potato-TXB 1992
Overgo hybridization and physical mapping 
CD22 was used as an overgo probe on plate 7 [well B1]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TCATATTCGGCTTAATCTTACATC
B sequence
GGCGAATTTCTGCACTGATGTAAG
AB sequence
TCATATTCGGCTTAATCTTACATCAGTGCA
Marker sequence
GGGGGGGGGGGGGNGAAAACCTTCATTATACTAAGGGGCATTACACATAC
AACATATTTTCGAGTGAGGATAAGTAATGCATTAAAAATATATTGACAAG
TTTTCATCTATCATATTCGGCTTAATCTTACATCAGTGCAGAAATTCGCC
AAGTTTGTAAGATTCTTTCATTTCCTTTATGGTCATCGAAGGTTAACTTT
CACCTTACATTAGATCTTCCATTCCATTATAACTGGCTTTTACATATACA
ACATCCTTT
Genomic location of CD22  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D292 marker 292
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)