SGN Marker T1958

SGN-M2920
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49498)
Chromosome
1
Position
71.97 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47432)
Chromosome
1
Position
49.51 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39805)
Chromosome
1
Position
46.00 cM
Confidence
CF(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1958 was used as an overgo probe on plate 8 [well D11]

Plausible BAC Matches:   P055E23

 Non-Plausible BAC matches

P066A04,   P001J06,   P109P17

 Overgo Sequences

A sequence
TGATCCCAAGGATCGTCCTAATGC
B sequence
TGCAAGAGCCTCTTCTGCATTAGG
AB sequence
TGATCCCAAGGATCGTCCTAATGCAGAAGA
Marker sequence
GTTGATGACCGATCTGTTGGGCACACCCTCCCCAGAATCCATTGCCAGGA
TAAGAAATGAAAAGGCTCGGAGGTATTTGAGCAGTATGCGTAAGAAAAAG
CCTGTACCTTTCTCCCATAAATTTCCACATGCAGATCCCCTTGCACTTCG
TTTGCTAGAAAGGATGCTTGCTTTTGATCCCAAGGATCGTCCTAATGCAG
AAGAGGCTCTTGCAGATCCATATTTCAGGAATCTAGCCAAAGTGGAAAGA
GAACCCTCTGCTCAACCAGTTACAAAAATGGAATTTGAGTTTGAAAGGCG
AAGGATAACAAAGGAGGATGTGAGGGAGCTGATATACAGAGAAATTCTTG
AATACCACCCAAAAATGTTGAAGGAGTTCTTAGAGGGGCAAGAACCTACA
GGTTTCATGTACCCAAGTGCCGTTGACAAATTCAAGAAGCAGTTTGCATA
TCTTGAAGAGCATTATGGCAAAGGAGGCGCTGCTGCTCCACCTGAGAGGC
AGCACTCATCATC
Genomic location of T1958  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2920 marker 2920
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)