SGN Marker cLET-5-J13

SGN-M2922

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C87709
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 51093)
Chromosome
1
Position
75.89 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 49029)
Chromosome
1
Position
55.78 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40401)
Chromosome
1
Position
52.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
cLET-5-J13 was used as an overgo probe on plate 9 [well B7]

Plausible BAC Matches:   P145G02,   P066C24,   P046J13,   P249H10,   P145G01,   P257N22,   P068G03,   P097L04,   P264N23,   P285A14,   P329A12,   P050G23,   P004C01

 Overgo Sequences

A sequence
CAGTGGAAGCTCTGAAAACAGCTC
B sequence
GGAGGTGATCCTTCTAGAGCTGTT
AB sequence
CAGTGGAAGCTCTGAAAACAGCTCTAGAAG
Marker sequence
TCCCCTAAAGCTGATTGCTTGTGCAATTGAGGAGGCTCAAGGTTTTGGAG
CTGTCTACAAATGGCTGAGATTGTCGAAGCAGATAATTACGAAGGCATAA
TCACAAGAATCGAGCACAAGTCCCGCAAGATCGAAAGTTTACTCAAACAG
TATAAACCAGTGGAAGCTCTGAAAACAGCTCTAGAAGGATCACCTCCTAA
GACCAAGGATGAAAGATGCAAGTCTGCTAATTGGATAGTGGTGCATAGGG
CTATAATGGCTATCAAGGATGTGGATAGCTTGTTCTCTGCATTGGATCCT
GAGTATTATGATATTCTCATGAAGTACTTGTACAGAGGTTTGTCTACTGG
AGACCGCCCAACATGTGACCAATGTCTAAGGATCCATGAAAAACTAACAG
AAAAAGCTGGTTTGGGATGCATACTGCGTTGTCTTGCTGACACTGTGAAT
ACTGTGTGACTAATACGCTGGGT
Genomic location of cLET-5-J13  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2922 marker 2922
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)