Notice: Please give us important feedback on the future of SGN using this survey: https://www.surveymonkey.com/r/VJTRHVC

SGN Marker cLED-15-I5

SGN-M2927

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C16197
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40296)
Chromosome
1
Position
87.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
cLED-15-I5 was used as an overgo probe on plate 10 [well A3]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TTTGAGTTTCGCCTCCGGATTACG
B sequence
TTCCATCTGATGCCAGCGTAATCC
AB sequence
TTTGAGTTTCGCCTCCGGATTACGCTGGCA
Marker sequence
CTGTTTCTTGCGAATCCAAGGAAAATCTTTCATTGACTTGCTGCTCAAAC
CTTCAGAAGATGATCTGAAGTTCTGGCCCCACAGTTTTGAGTTTCGCCTC
CGGATTACGCTGGCATCAGATGGAAGCTTGTCCTTGATATCTCGGATCAG
AAATATTAATGGCAAACAGTTCAGCTTCTCATTTGCTTATCATACATACT
TCTCTGTTTCCGACATAAGTGAAATAAGGATCGAAGGTTTAGAAACACTG
GACTATCTGGACAACCTATGCCAGAAAGAACGCTTTACTGAACAAGGAGA
TGCCATAACTTTTGAATCTGAGATGGACCGTGTCTACCTTAGTTCTCCTA
ATCGCATTGCTGTTCTTGATCATGAAAGGAAACGGACATATCTGATAAGG
AAGGAAGGACTGCCAGATACTGTGGTGTGGAATCCATGGGAGAAGAAAGC
CAAAGCAATGGTGGATTTTGGTGATGATGAGTATAAACAGATGCTTTGTG
TTGATGGAGCAGCAATAGAAAAACCCATCACCTTGAAGCCAGGAGAGGAA
TGGACCGGTCGTGTAGAGCTT
Related Markers  

Related Genotyped Markers: These markers have been genotyped and share a name with this marker

Genomic location of cLED-15-I5  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2927 marker 2927
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)