SGN Marker CD23

SGN-M293

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
750
Vector
pUC
Cutting Site
PST1
Drug Resistance
AMP
Image
CD23 image not available
Forward sequence
CTGCAGGGGGGGGGGGNGAGAAAAATTGGCCCTGATGAGACACCCCTTGGGTTCAAGGTCATATAACAAAAGGCTTTGAAGCACTTGAAA
AGCTACTTAAAGATTATGCTGGGAAGTATGCAACAGGAGATGAAGTTTACATGGCCGACTTGTTTCTGGCACCTCAGATCCATGCAGCAA
TCAAGCGTTTTGAAGTTGACATGAATCAATTCCCTACTCTGTTGAGGGTATTTGAGGCTTACCAAGAGCTGCCTGCTTTCCAGGATGCTA
TGCCAGAAAAACAGCCTGATGCCACATGCTGAAGGCCATCCATCATCTATGAAGTTCCCTTCTCAAACCCTTGGCATAACTGGAGTTGCA
TTTTGGCAGAATTGTTAGCTGTTTGCTGCACATTCTATTTCTGAATGCATTTGCCTTTAGTAAACTTCTATACGATGAATAAATGTAGAG
CTGTCAGTGGCACACTTCTTTACGATGAATACATGTAGAGCTGTGTAACACTTGNCAACTTCTTTACAGTGAATAATGTAGAGCCGTGTA
ATACTTCAGTTATGGCACAGTCACGAGTTACTGAAGTACAGATAGTGAAAATG
Reverse sequence
TGCAGGGGGGGGGGGGGGAACTTTATAATATCTCAAATAGACGGAGGAATGTTCATCCTAGGTTCCTTAACATAGGTAGTACAACACCAT
TTTCACTATCTGTACTTCAGTAACTCGTGACTGTGCCATAACTGAAGTATTACACGGCTCTACATTATTCACTGTAAAGAAGTTTGCAAG
TGTTACACAGCTCTACATGTATTCATCGTAAAGAAGTGTGCCACTGACAGCTCTACATTTATTCATCGTATAGAAGTTTACTAAAGGCAA
ATGCATTCAGAAATAGAATGTGCAGCAAACAGCTAACAATTCTGCCAAAATGCAACTCCAGTTATGCCAAGGGTTTGAGAAGGGAACTTC
ATAGATGATGGATGGCCTTCAGCATGTGGCATCAGGCTGTTTTTCTGGCATAGCATCCTGGAAAGCAGGCAGCTCTTGGTAAGCCTCAAA
TACCCTCAACAGAGTAGGGAATTGATTCATGTCAACTTCAAAACGCTTGATTGCTGCATGGATCTGAGGTGCCAGAAACAAGTCGGCCAT
GTAAACTTCATCTCCTGTTGCATACTTCCCAGCATAATCTTTAAGT
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1590417.1e-1060 (10.1% of RFLP seq)+
SGN-U1609355.3e-2362 (10.5% of RFLP seq)+
SGN-U1645183.6e-3070 (11.8% of RFLP seq)+
SGN-U1609338.3e-96184 (31.0% of RFLP seq)+
SGN-U1609341e-106265 (44.7% of RFLP seq)+
SGN-U144065394 (66.4% of RFLP seq)+
SGN-U144066574 (96.8% of RFLP seq)+
SGN-U1590417e-1060 (10.2% of RFLP seq)-
SGN-U1645181.3e-2050 (8.5% of RFLP seq)-
SGN-U1609337.8e-56109 (18.6% of RFLP seq)-
SGN-U1609347e-152334 (57.0% of RFLP seq)-
SGN-U144065319 (54.4% of RFLP seq)-
SGN-U144066568 (96.9% of RFLP seq)-
Mapped locations  
Map: Tomato-EXPEN 1992   
Map version
28 (location: 8825)
Chromosome
1
Position
100.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
CD23 was used as an overgo probe on plate 5 [well A11]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P323H17,   P175O01,   P089E04,   P006N14,   P065J03,   P311H18

 Overgo Sequences

A sequence
TTACATGGCCGACTTGTTTCTGGC
B sequence
TGCATGGATCTGAGGTGCCAGAAA
AB sequence
TTACATGGCCGACTTGTTTCTGGCACCTCA
Marker sequence
CTGCAGGGGGGGGGGGNGAGAAAAATTGGCCCTGATGAGACACCCCTTGG
GTTCAAGGTCATATAACAAAAGGCTTTGAAGCACTTGAAAAGCTACTTAA
AGATTATGCTGGGAAGTATGCAACAGGAGATGAAGTTTACATGGCCGACT
TGTTTCTGGCACCTCAGATCCATGCAGCAATCAAGCGTTTTGAAGTTGAC
ATGAATCAATTCCCTACTCTGTTGAGGGTATTTGAGGCTTACCAAGAGCT
GCCTGCTTTCCAGGATGCTATGCCAGAAAAACAGCCTGATGCCACATGCT
GAAGGCCATCCATCATCTATGAAGTTCCCTTCTCAAACCCTTGGCATAAC
TGGAGTTGCATTTTGGCAGAATTGTTAGCTGTTTGCTGCACATTCTATTT
CTGAATGCATTTGCCTTTAGTAAACTTCTATACGATGAATAAATGTAGAG
CTGTCAGTGGCACACTTCTTTACGATGAATACATGTAGAGCTGTGTAACA
CTTGNCAACTTCTTTACAGTGAATAATGTAGAGCCGTGTAATACTTCAGT
TATGGCACAGTCACGAGTTACTGAAGTACAGATAGTGAAAATG
Genomic location of CD23  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D293 marker 293
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)