SGN Marker T1964

SGN-M2932
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39811)
Chromosome
1
Position
98.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1964 was used as an overgo probe on plate 3 [well H10]

Plausible BAC Matches:   P286K14,   P054D16,   P211D01,   P300K07,   P274D08,   P329A13,   P286L15

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
CTGATATGGGTGGCATGGGTTTCA
B sequence
GAGTGGTTGGACTGAATGAAACCC
AB sequence
CTGATATGGGTGGCATGGGTTTCATTCAGT
Marker sequence
CTCCTCCATACTTTTACAGAATGGGAAGCTCTGGTGGTATTGACTATGGT
TCTTACACTTATGAGAATCTTGAGAGGGAACCTTACTGGCCGTCTGAGAA
GCTCCGTATTTCCATTACTGGGGCTGGAGGGTTTATCGCTTCTCACATTG
CTCGCCGTTTGAAGAGCGAGGGCCACTACATAATTGCCTCTGATTGGAAG
AAGAATGAGCACATGACAGAGGATATGTTCTGTCATGAGTTTCATCTTGC
GGATCTTAGGGTTATGGATAATTGCTTGAAGGTAACAAAAGGTGTTGACC
ATGTCTTCAACCTTGCTGCTGATATGGGTGGCATGGGTTTCATTCAGTCC
AACCACTCTGTTATCTTCTATAACAACACTATGATCAGCTTCAATATGAT
GGAAGCTGCTAGGATTAACAGTGTCAAAAGGTTCTTCTATGCATCTAGCG
CTTGCATATACCCTGAGTTCAAACAACTTGAAACAAATGTCAGCCTGAAA
GAAGCTGATGCATGGCCTGCANAGCCTCAAGATGCATATGGTTTGGAGAA
GCTTGCCCA
Genomic location of T1964  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2932 marker 2932
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)