SGN Marker cLET-14-E21

SGN-M2935

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C81048
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40361)
Chromosome
1
Position
129.00 cM
Confidence
CF(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
cLET-14-E21 was used as an overgo probe on plate 8 [well H1]

Plausible BAC Matches:   P302B12,   P122A12,   P252E02,   P297F02,   P336N23,   P138I02,   P077J17,   P001M12,   P310L17,   P016B10,   P189G15,   P332H04,   P057K03

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
TTGTCTAAACGGGCTCTGCTCATG
B sequence
ACTGGTTCGCCGATGACATGAGCA
AB sequence
TTGTCTAAACGGGCTCTGCTCATGTCATCG
Marker sequence
ACTAGATATATCTTCCTTTATATACAAGTGCAGAACCTTCACTTTCTACT
TAGAAAAATGAATGTGCAAAACACAACATTCCACAATAACAAATTATCAG
TCACTACCAACACTCTAATTAACTGTCCTGCTTCTATAAAATCGACAGAA
AACCATAAACATCATAAAACTGGCTGCACTTGACAATGCCAGAAACCAGT
AATAGTTGTCTAAACGGGCTCTGCTCATGTCATCGGCGAACCAGTTCTGC
TTTTCTCCTATTGAACTTGTCAAATGTTCAATCACTGTTATAAGGAATGA
GCTGAAGAAACTACCACAACCAAATACACTAGTATAAAGAGCTATGCCTA
AAGTTCTCATATTTATCGGAACTTCAGAGTAAAAGAACTCTTGCATACCA
ACAACTGTGAATATATCTGAAATTCCCAATAAGATGTACTGAGGCAGCAA
CCAAAATATGCTCATTGGCAAAGCTTCGAATTCTGAAGTTAAAGTACCTA
CATTTCTGGCAATATCCAGTC
Genomic location of cLET-14-E21  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2935 marker 2935
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)