SGN Marker cTOB-9-J12

SGN-M2942

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C123172
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40506)
Chromosome
1
Position
164.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
cTOB-9-J12 was used as an overgo probe on plate 3 [well H8]

Plausible BAC Matches:   P031F12,   P031J13

 Overgo Sequences

A sequence
GAACCCGAGTTCATCTTCTCAACA
B sequence
GAGGAATTTGCGCCATTGTTGAGA
AB sequence
GAACCCGAGTTCATCTTCTCAACAATGGCG
Marker sequence
TTCTCTCTTTTGTTGAACCCGAGTTCATCTTCTCAACAATGGCGCAAATT
CCTCATATAGCAATTTTACCTTCTCCTGGTATGGGTCATTTAATCCCTCT
TGTCGAATTTGCTAAGAGAATTTTTCTCCATCATCACTTTTCTGTTTCTC
TGATTCTCCCTACTGATGGCCCAATTTCTAACGCTCAGAAAATTTTTCTG
AACTCGCTTGCTTCTTCCATGGATTATCATCTTCTTCCTCCGGCTAATTT
CGATGATTTACCTGAAGATGTTAAAATCGAGACTCGAATTTCACTTACTG
TTTCTCGTTCTCTTACTTCACTGCGTCAAGTTTTGGAATCTATTATTGAG
TCTGA
Genomic location of cTOB-9-J12  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2942 marker 2942
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)