SGN Marker cLET-20-K6

SGN-M2943

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C82625
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40370)
Chromosome
10
Position
0.00 cM
Confidence
I
Protocol
RFLP
Subscript
A


Tomato-EXPEN 2000

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40371)
Chromosome
5
Position
12.00 cM
Confidence
CF(LOD3)
Protocol
RFLP
Subscript
B


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
cLET-20-K6 was used as an overgo probe on plate 11 [well G2]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P162B13,   P074B07,   P070K09,   P050P24,   P162A03,   P074F23,   P091M10,   P026N22

 Overgo Sequences

A sequence
CTCTAGTGAAGAGTGCTATTGTGC
B sequence
GGAGCTGCATCAACTTGCACAATA
AB sequence
CTCTAGTGAAGAGTGCTATTGTGCAAGTTG
Marker sequence
TGAAGTGGCGTGCTTTGAGGTTTGACACTGTTAATTACTCTTGGGGTAGT
GAAGCTGTTACTAGGAAGACCCGTTTATTGGATGTTGTCTACAATGCCTC
AAACAACGAGTTGGTTAGAACACAAACTCTAGTGAAGAGTGCTATTGTGC
AAGTTGATGCAGCTCCATTTAAACAGTGGTATCTCCAGCACTATGGTGTT
GAAATTGGTCGCAAGAAGAAGAGTGCTGCCAAGAAGGAAGGAGAGGAGGT
TGCTGAGGCTGCTGTAGAGGAGA

cLET-20-K6 was used as an overgo probe on plate 15 [well A12]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P091M10,   P316O19,   P162A03

 Overgo Sequences

A sequence
CTCTAGTGAAGAGTGCTATTGTGC
B sequence
GGAGCTGCATCAACTTGCACAATA
AB sequence
CTCTAGTGAAGAGTGCTATTGTGCAAGTTG
Marker sequence
TGAAGTGGCGTGCTTTGAGGTTTGACACTGTTAATTACTCTTGGGGTAGT
GAAGCTGTTACTAGGAAGACCCGTTTATTGGATGTTGTCTACAATGCCTC
AAACAACGAGTTGGTTAGAACACAAACTCTAGTGAAGAGTGCTATTGTGC
AAGTTGATGCAGCTCCATTTAAACAGTGGTATCTCCAGCACTATGGTGTT
GAAATTGGTCGCAAGAAGAAGAGTGCTGCCAAGAAGGAAGGAGAGGAGGT
TGCTGAGGCTGCTGTAGAGGAGA
Genomic location of cLET-20-K6  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2943 marker 2943
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)