SGN Marker cLES-2-K4

SGN-M2947

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C77613
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40355)
Chromosome
10
Position
33.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
cLES-2-K4 was used as an overgo probe on plate 16 [well G4]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
AGTTGCCACAACTTGCGGGAACTT
B sequence
GCTGCTCCTTCAATAGAAGTTCCC
AB sequence
AGTTGCCACAACTTGCGGGAACTTCTATTG
Marker sequence
CGGCAAAAGTTGCCACAACTTGCGGGAACTTCTATTGAAGGAGCAGCAAA
GGGTGGCTACATTGTATCAGACAATTCTTCAGGCAACAAACCTGATGTCA
TTTTGATCGGTACTGGTTCCGAGTTGGAAATTGCTGTCAAGGCTGCTGAG
GAACTAAAGAAAGAAGGAAAGACAGTGAGGGTTGTTTCCTTTGTTTGTTG
GGAGCTTTATGATGAACAATCAGCTGAATACAAGGAAAGTGTCCTTCCAT
CATCTGTTACAGCTAGAGTTAGTATTGAAGCTGGATCAACATTCGGGTGG
CAAAAATTTGTTGGCGATAAAGGAAAAGCTATTGGGGTTGACGGGTTTGG
TGCTAGTGCTCCTGCTGATAAGATATACAAAGAGTTTGGTATTACAGCAG
AAGCTGTTGTAGCTGCAGCTAAACAAGTTTCTTAGGCGATGTCCATTACA
ATTCTTGCTGGTCTACTCTACTGAATGAGATAATG
Genomic location of cLES-2-K4  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2947 marker 2947
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)