SGN Marker cLET-3-F16

SGN-M2948

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C85570
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40383)
Chromosome
10
Position
34.00 cM
Confidence
CF(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
cLET-3-F16 was used as an overgo probe on plate 6 [well C4]

Plausible BAC Matches:   P253J01,   P079P16,   P050N16,   P218O01,   P012D23,   P001G19,   P139B01,   P144M14,   P161C15,   P060I17,   P194F03,   P023C05,   P078A05,   P310B19,   P044M13,   P242J02,   P027P06,   P151N15,   P243M09,   P272M18,   P262L10,   P100I21,   P002M01,   P102K20,   P011L04,   P044H12,   P317H21

 Non-Plausible BAC matches

P014O17,   P302I06,   P168C11,   P033D18

 Overgo Sequences

A sequence
TTACTCATGCAGGGCTGGTTCTTG
B sequence
TCCAGCACAAGATGAGCAAGAACC
AB sequence
TTACTCATGCAGGGCTGGTTCTTGCTCATC
Marker sequence
TGGCTAGTATTTCTGGTACAATGATTAGCACTTCTTTCCTTCCAAGAAAG
CCAGCTGTGACTAGCCTCAAAGCCATATCAAATGTTGGTGAAGCTTTGTT
TGGTCTTAAATCTGGTAGAAATGGGAGGATTACTTGCATGGCCAGTTACA
AAGTGAAGCTTATTACACCAGAAGGACCTATTGAATTTGAATGCCCAGAT
GATGTTTACATTCTTGACCAAGCTGAGGAAGAAGGACATGACCTTCCTTA
CTCATGCAGGGCTGGTTCTTGCTCATCTTGTGCTGGAAAAGTTACTGCTG
GAAGTGTTGATCAGTCTGATGGAAACTTCCTTGATGAGGACCAAGAAGCT
GCTGGATTTGTGCTTACTTGTGTTGCTTACCCAAAGGGTGATGTTACCAT
TGAGACTCACAAGGAGGAGGAGCTTACTGCTTAAATTACAACCATTTNCA
TTTTAATAAAAAACAACACTTCATTTTGTTTCATGAGCATTTACTTTTCA
CATTNTCCCTCTATTGTTATCACAAAAGNTGCTATCTAGTTATTTGTGCC
Genomic location of cLET-3-F16  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2948 marker 2948
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)