SGN Marker cLED-11-F6

SGN-M2949

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C15246
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 51069)
Chromosome
10
Position
52.26 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 49005)
Chromosome
10
Position
30.76 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40294)
Chromosome
10
Position
35.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
cLED-11-F6 was used as an overgo probe on plate 6 [well D3]

Plausible BAC Matches:   P163E14,   P288F24,   P092K18,   P163H06,   P250K18,   P175M04,   P318K13,   P296O13

 Non-Plausible BAC matches

P212C02,   P045P14,   P008L22,   P247J01,   P294M03

 Overgo Sequences

A sequence
GCTACTGTGAAAACTGGAATCAGG
B sequence
AAGCCTCCATTTGCTGCCTGATTC
AB sequence
GCTACTGTGAAAACTGGAATCAGGCAGCAA
Marker sequence
GCACCAGCCTGGCTATCCTGAATATATTCTTAAAGCAGGCGACGAGAATT
AACTTGGAGGAGTATATTTCTTTGGTAGTTGATGCTACTGTGAAAACTGG
AATCAGGCAGCAAATGGAGGCTTTTAGATCTGGCTTCAATCAGGTTTTCG
ACTTTTCAGCTCTGCAAATATTCTCTCCTTCAGAGTTAGACTATCTATTA
TGTGGCCGTAGAGAGCTGTGGAAGCCTGAGACGCTAGTAGATCACATAAA
ATTCGATCATGGATTCACATCCAAGAGTCCTCCTATTATTCATTTACTAG
AGATTATGGGAGAGTTCACACCTGAGCAGCAACGAGCATTCTGCCAGTTT
GTTACTGGTGCTCCTCGGCTCCCCGCAGGTGGTCTTGCTTCTCTGAATCC
TAAGTTGACAATTGTGAGGAAGCATTCATCTAGTGCTGGCAATGCAGCAC
AGAACAGTAATGCCCCATCAGAATCTGCAGATGAAGACCTACCCAGTGTG
ATGACATGTGCTAATTACTTGAAACTCCCTCCCTATTCTACTAAAGAGAT
CATGTCCAAGAAATTACTCTATGCCATTAATGAAGGTCAAGG
Genomic location of cLED-11-F6  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2949 marker 2949
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)