SGN Marker cLET-8-G3

SGN-M2950

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C88492
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40422)
Chromosome
10
Position
41.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
cLET-8-G3 was used as an overgo probe on plate 6 [well G8]

Plausible BAC Matches:   P188N09

 Overgo Sequences

A sequence
AGCAGCATTGAAGGAGGAACCAAG
B sequence
GCTTGTTCACTAGCCACTTGGTTC
AB sequence
AGCAGCATTGAAGGAGGAACCAAGTGGCTA
Marker sequence
GAAAACTCGATTCCACTTTATCTCTCTGAATTGGACTCAGAGAGAGAGAG
GGAGGAAGGAGGAAGAAGAGTTGTTTAAGCTTTTGGATTTTTTGTTATTG
GGTTTATAGAAATCTTCGACATTGAGAATGGATCAGATATTGAACAAAGT
GGGTTCTTACTGGATAGGTAAAAGAGCCAACAAGGAGATCAATTCCGTCG
GCGATGACATTAATTCATTGCAAAGCAGCATTGAAGGAGGAACCAAGTGG
CTAGTGAACAAGCTTAAAGGAAAAATGCAAAAGCCATTGCCAGATCTTCT
GAAGGAATATGATGTTCCAGTAGGTATTTTTCCTCGTGATGCCACCAATT
ACGAGTTCAATGAAGAAACACGAAAGCTCACAGTCTTTATACCCTCTGTA
TGTGAAGTTGGCTACAAGGATTCATCTGTATTGCGCTTCTCTACAGCTGT
TACTGGATATCTGGAAAAAGGAAAGCTAGTCGAGATTGAAGGAATGAAAA
CAAAGGTGATGGTGTGGGTAAAAGTTACTGCCATCTCTTCAG
Genomic location of cLET-8-G3  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2950 marker 2950
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)