SGN Marker T1967

SGN-M2951
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39813)
Chromosome
10
Position
44.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1967 was used as an overgo probe on plate 15 [well E11]

Plausible BAC Matches:   P248A13,   P281I11,   P071D20

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
ACATCAGCTAAGAGCCACTGCATC
B sequence
GGAAATGACTCGAGCAGATGCAGT
AB sequence
ACATCAGCTAAGAGCCACTGCATCTGCTCG
Marker sequence
GAAACATCAGCTAAGAGCCACTGCATCTGCTCGAGTCATTTCCTTTGACC
GAAGAGTGGGGCTAACAGAAAAGCTTACGGTTGGAATTTCTGTTGTAAAT
GAGAAAGTTAAATCTGTTGATCAAAGGCTTCAAGTGTCAGATAAAACGAT
GGCTGCAGTTATGGCAGCAGAACGGAAATTGAATGACACAGGATCAGCAG
TCAAATCAAGCAGGTATGTTAATGCTGGAGCTGCCTGGCTGAATGGTGCT
TTCAGTAAAGTAGCTAAGGCAGGGCAAGTTGCTGGTACAAAAACGAGAGA
AAAATGGAATTTTGCGTTGTCAAATTTGACAGCAAAGGATCCTTCTATTG
TTGCCTAGATCATAGACGAAAATTTGGTATATTGGAGTTGCTAAGTTGCC
TCTGTCGAATAGCTTGGGATTCCAAATACTATTTCCTTGCACATCTAGAA
ATTGGGATCTGGTATGCAGATTGCAGATCGTCTGTGTCAAATTCAAGCAA
GTTTCATCTGTGATGTGATTTTTCTAATAGTTAACCCCTCTTGCCATTTT
ATTGTGGAATGTGGAGTGGTGTGGTGTGGTGTGGTCAATACAACTATACG
Genomic location of T1967  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2951 marker 2951
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)