SGN Marker cLED-16-N20

SGN-M2952

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C16547
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40297)
Chromosome
10
Position
52.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
cLED-16-N20 was used as an overgo probe on plate 16 [well G3]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GAGCATTTGACAGTGGACGAAGTG
B sequence
CCTCCTTTATTCCAGCCACTTCGT
AB sequence
GAGCATTTGACAGTGGACGAAGTGGCTGGA
Marker sequence
GAGAGACTATGGTCCAGAAGTAGATGTCTGGAGTGCTGGAGTAATTCTCT
ACATCTTGCTATGTGGTGTTCCACCATTTTGGGCAGAAACTGAACAAGGA
GTTGCACAAGCAATCATTCGTTCTGTTGTGAATTTTAAAAGGGACCCTTG
GCCTAAGGTATCCGACAATGCAAAAGACCTTGTGAAGAAGATGCTTAACC
CTGATCCTAGCCAGAGGCTTACTGCTCAAGAAGTTCTAGATCATCCCTGG
ATACAAAATGCAAAGAAGGCTCCAAATGTTTCTTTGGGTGAAACAGTGAA
AGCAAGGCTCAAGCAATTCTCTATGATGAACAAGCTAAAGAAAAGAGCTT
TAAGGGTGATTGCTGAGCATTTGACAGTGGACGAAGTGGCTGGAATAAAG
GAGGGATTCCAATTGATGGATATAAGTAACAAAGGGAAGATTGACGTTAA
CGAGTTGAGAGTTGGGTTGCAGAAACTTGGCCATTCAATTCCCGAATCTG
ATGTACAGATTCTTATGGATGTTGGTGATGTCGA
Genomic location of cLED-16-N20  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2952 marker 2952
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)