SGN Marker cLET-3-K21

SGN-M2953

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C85643
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40384)
Chromosome
10
Position
53.00 cM
Confidence
CF(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
cLET-3-K21 was used as an overgo probe on plate 16 [well C7]

Plausible BAC Matches:   P206B16

 Non-Plausible BAC matches

P320E22,   P313H24,   P090F06,   P118D22,   P035L03,   P285C17,   P312K20,   P117F20,   P257J02,   P302B08,   P066L24,   P313O21,   P031N18,   P029N19

 Overgo Sequences

A sequence
CCATGACTACTGGATGAGCCAGAA
B sequence
ATATTCCTCTCCCTGGTTCTGGCT
AB sequence
CCATGACTACTGGATGAGCCAGAACCAGGG
Marker sequence
TCTGTTTAAAGGTATTAATTTCGAAAAAGCAATATGGCATTAGTTTCTGG
AGGAAGATCAACGCTGAATCCAAATGCGCCCCTCTTTGTTCCTTCATTTG
TGCGCCAGGTAGAGGATTTTTCACCAGAATGGTGGAACTTGGTGACAACT
TCAACATGGTTCCATGACTACTGGATGAGCCAGAACCAGGGAGAGGAATA
TGGTGCTGGTAATGATGTTGCTGATTTGCTTCCTGAAAATATTGATCTCA
ATGTTGATGAGGACATCTTGAACATGGAAGCTCAGTTTGAGGAATTTCTT
CAATCTTCCGAAAATGAGCAACAAGGAATTAAGTCATCTCTCTATGGTGT
CAATGCGATGCCACAATATGGTTTACCATCTGATGCACTGATTAGAACAT
TGAGTTCACCAAGATCCCCCATTGGTCCACCCAAATACTTTGAGAAGCCA
TCCAAGATCGTGAGCCCGAGGAACAGTTTCCGCAGCATCCAGCAGCCTCG
TTGAATTCCCAGTCTCTTGGTTTACTTTCAGGAAGTCAGATGTTAGTTTG
CAGCAGTTTAGAAAGTCTTCAAGTTTTAGTTTCATGTAACCTTTGTATAG
AACAA
Genomic location of cLET-3-K21  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2953 marker 2953
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)