SGN Marker cLEX-11-C19

SGN-M2954

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C92397
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 51107)
Chromosome
10
Position
60.36 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 49043)
Chromosome
10
Position
49.78 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40430)
Chromosome
10
Position
53.00 cM
Confidence
CF(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
cLEX-11-C19 was used as an overgo probe on plate 16 [well E2]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
ATTGGGTTTGCCGTCTTTAGGGAC
B sequence
CAAGAACTTCCCGTCTGTCCCTAA
AB sequence
ATTGGGTTTGCCGTCTTTAGGGACAGACGG
Marker sequence
GCGAGTTTTATTTTCGTCACTGAGTCAGGAACTAAGGAATCCAAATTTTT
AGGAGTTGTGTGTAAGTCTACTTGGAACGGTTTGAGTGACAAGCAAGCTA
GAATTTCTGATTATATGAACGTTTCTCCGGTCACTCTGCCTTCAAGCTAT
AATTTTGAGGACGTAGCAGGCTACATAGCATCTAAAAAGCTGGACTTTGT
ACCATTGGTGAATGAAAAGGATAGGGAAGTGGTCAATTTGGTGACAGCTA
CTGACTTGGAGAGAATGAATTCGCTTCCCAAATTGGGTTTGCCGTCTTTA
GGGACAGACGGGAAGTTCTTGGTGGGTGCAGCAATAGGGACGAGGGATTC
TGATAAAGAGAGGCTGGAGCATTTGGTGAAAGCTGGGATTAACGCTCTCG
TGATTGATAGCTCGCAAGGGAACTCAGAGTATCAGATTAATATGATCAAG
TATGTGAAACATACTTATCCTCACTTGGATGTGATTGGTGGAAATATAGT
CACTAAGTACCAAGCGGAGAACTTGATTAAGCATGATGTAGATGGACTGA
GAGTCGGGATGGGCTCCGGGTCCATCTGTACCACTCAAGAAGTTTGTGCT
GTGGGTCGTGGACAGGCGACTGCTGTTT
Genomic location of cLEX-11-C19  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2954 marker 2954
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)