SGN Marker cTOB-8-M7

SGN-M2956

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C123031
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 51124)
Chromosome
10
Position
61.14 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 49059)
Chromosome
10
Position
53.09 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40503)
Chromosome
10
Position
57.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
cTOB-8-M7 was used as an overgo probe on plate 15 [well E10]

Plausible BAC Matches:   P005D06

 Overgo Sequences

A sequence
GTCGGTGTCGAAGTTAACAAGCAG
B sequence
GGATACGATCACGAACCTGCTTGT
AB sequence
GTCGGTGTCGAAGTTAACAAGCAGGTTCGT
Marker sequence
GCCGGAGAAAGGCGGAGGAAAATGCCGGCCGGCCATGGATTGAGGTCTCG
TACGAGAGATTCATTCTCTCGTGCATTTAGAAAGAAAGGTACAATTCACC
TTTCAACCTACCTGAGAATCTTCAAAATCGGCGATTATGTTGATATCAAA
GTGAACGGTGCAATTCACAAGGGAATGCCGCACAAATTCTATCATGGCCG
TACCGGACGTGTCTGGAACGTCACCAAACGCGCCGTCGGTGTCGAAGTTA
ACAAGCAGGTTCGTGATCGTATCCTAAGGAAGAGGATCCACGTTAGGATT
GAACATGTTCAAGCTTCTCGATGCACCGAAGAAGTC
Genomic location of cTOB-8-M7  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2956 marker 2956
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)