SGN Marker cTOA-5-G7

SGN-M2961

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from EST clone SGN-C117171
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 51123)
Chromosome
11
Position
0.65 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 49058)
Chromosome
11
Position
6.53 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40493)
Chromosome
11
Position
3.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
cTOA-5-G7 was used as an overgo probe on plate 3 [well B2]

Plausible BAC Matches:   P269J18,   P054I23,   P192G19,   P116H08,   P219H11,   P156L21,   P290G09,   P048F06

 Overgo Sequences

A sequence
CGGAAGGATGTATTGGACTTGCAG
B sequence
AACCATCAGCAGACCACTGCAAGT
AB sequence
CGGAAGGATGTATTGGACTTGCAGTGGTCT
Marker sequence
GGAGAGATCAGGAAGCAACAAATAAGGATGAAGGGTGGTACAGTTCAGAT
CAATTGGCACGACAGTAAGCCAGTTTTGTGCCTTGATTTTCACCACCTCA
CCGGCGTTATTGCTACTGGTGGCGCCGACTATGATATCAAGATGTGGGTG
ATTGATTCTGAAGAAAATGAAAAGAAAGCGCCTTCAGTTACATACCAGGC
TAGCCTTTCTTACCATAGTGGTGCTGTGAATGCTCTTCGGTTCTCCCCTT
CAGGAGAGCATTTGGCCTCTGGTGCCGATGGCGGCGAGCTCATCATTTGG
AAGCTACATTCTTCAGATGACAGCAAAACATGGAAAGTCCTAAAGACGTT
ATCATTTCACCGGAAGGATGTATTGGACTTGCAGTGGTCTGCTGATGGTT
CTTTTTTAATTTCTGGTTCTGTTGATAATTCATGCATCGTATGGGATGTC
AACAAAGGTTCTGTTCATCAGATTTTGGATGCTCATTTGCACTATGTGCA
AGGTGTGGCATGGGATCCATTGTCCAAGTATACTGCCTCACTCAGTTCAG
ATAGATCTTGCCGGATTTACAGCAATAGACCATCTAAAACAAAAGGAGTT
GAGAAGTTGAATTTTGTGTGTCAACATGTCATTATGA
Genomic location of cTOA-5-G7  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2961 marker 2961
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)